ID: 1197096416

View in Genome Browser
Species Human (GRCh38)
Location X:122601624-122601646
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197096414_1197096416 -1 Left 1197096414 X:122601602-122601624 CCAATACCAGATAAGAACACAGC No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data
1197096415_1197096416 -7 Left 1197096415 X:122601608-122601630 CCAGATAAGAACACAGCAAACAA No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data
1197096413_1197096416 6 Left 1197096413 X:122601595-122601617 CCTGATACCAATACCAGATAAGA No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data
1197096411_1197096416 16 Left 1197096411 X:122601585-122601607 CCAGCATTACCCTGATACCAATA No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data
1197096412_1197096416 7 Left 1197096412 X:122601594-122601616 CCCTGATACCAATACCAGATAAG No data
Right 1197096416 X:122601624-122601646 CAAACAAAGAAAACTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197096416 Original CRISPR CAAACAAAGAAAACTACAGA AGG Intergenic