ID: 1197097462

View in Genome Browser
Species Human (GRCh38)
Location X:122612783-122612805
Sequence GCCTTGCTCAAAAATCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197097462_1197097467 27 Left 1197097462 X:122612783-122612805 CCTGTAGGATTTTTGAGCAAGGC No data
Right 1197097467 X:122612833-122612855 TCCTTTTGAGAGACAGGTTTTGG No data
1197097462_1197097466 21 Left 1197097462 X:122612783-122612805 CCTGTAGGATTTTTGAGCAAGGC No data
Right 1197097466 X:122612827-122612849 CTATTCTCCTTTTGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197097462 Original CRISPR GCCTTGCTCAAAAATCCTAC AGG (reversed) Intergenic
No off target data available for this crispr