ID: 1197097462 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:122612783-122612805 |
Sequence | GCCTTGCTCAAAAATCCTAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1197097462_1197097467 | 27 | Left | 1197097462 | X:122612783-122612805 | CCTGTAGGATTTTTGAGCAAGGC | No data | ||
Right | 1197097467 | X:122612833-122612855 | TCCTTTTGAGAGACAGGTTTTGG | No data | ||||
1197097462_1197097466 | 21 | Left | 1197097462 | X:122612783-122612805 | CCTGTAGGATTTTTGAGCAAGGC | No data | ||
Right | 1197097466 | X:122612827-122612849 | CTATTCTCCTTTTGAGAGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1197097462 | Original CRISPR | GCCTTGCTCAAAAATCCTAC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |