ID: 1197097464

View in Genome Browser
Species Human (GRCh38)
Location X:122612806-122612828
Sequence AGTTATCTGCAGAAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197097464_1197097467 4 Left 1197097464 X:122612806-122612828 CCTACCATCTTCTGCAGATAACT No data
Right 1197097467 X:122612833-122612855 TCCTTTTGAGAGACAGGTTTTGG No data
1197097464_1197097470 16 Left 1197097464 X:122612806-122612828 CCTACCATCTTCTGCAGATAACT No data
Right 1197097470 X:122612845-122612867 ACAGGTTTTGGCCTGTTACTGGG No data
1197097464_1197097469 15 Left 1197097464 X:122612806-122612828 CCTACCATCTTCTGCAGATAACT No data
Right 1197097469 X:122612844-122612866 GACAGGTTTTGGCCTGTTACTGG No data
1197097464_1197097466 -2 Left 1197097464 X:122612806-122612828 CCTACCATCTTCTGCAGATAACT No data
Right 1197097466 X:122612827-122612849 CTATTCTCCTTTTGAGAGACAGG No data
1197097464_1197097471 22 Left 1197097464 X:122612806-122612828 CCTACCATCTTCTGCAGATAACT No data
Right 1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197097464 Original CRISPR AGTTATCTGCAGAAGATGGT AGG (reversed) Intergenic
No off target data available for this crispr