ID: 1197097471

View in Genome Browser
Species Human (GRCh38)
Location X:122612851-122612873
Sequence TTTGGCCTGTTACTGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197097464_1197097471 22 Left 1197097464 X:122612806-122612828 CCTACCATCTTCTGCAGATAACT No data
Right 1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG No data
1197097463_1197097471 23 Left 1197097463 X:122612805-122612827 CCCTACCATCTTCTGCAGATAAC 0: 7
1: 193
2: 178
3: 130
4: 224
Right 1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG No data
1197097465_1197097471 18 Left 1197097465 X:122612810-122612832 CCATCTTCTGCAGATAACTATTC 0: 14
1: 194
2: 203
3: 139
4: 330
Right 1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG No data
1197097468_1197097471 -6 Left 1197097468 X:122612834-122612856 CCTTTTGAGAGACAGGTTTTGGC No data
Right 1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197097471 Original CRISPR TTTGGCCTGTTACTGGGCTT TGG Intergenic
No off target data available for this crispr