ID: 1197098179

View in Genome Browser
Species Human (GRCh38)
Location X:122620471-122620493
Sequence CAGGTACACCAATTAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197098174_1197098179 7 Left 1197098174 X:122620441-122620463 CCAACTTGGTTCCATTCTCCCTG 0: 1092
1: 2704
2: 3836
3: 2352
4: 1152
Right 1197098179 X:122620471-122620493 CAGGTACACCAATTAAATGTAGG No data
1197098175_1197098179 -4 Left 1197098175 X:122620452-122620474 CCATTCTCCCTGTCATTTTCAGG 0: 27
1: 1238
2: 2988
3: 3874
4: 2456
Right 1197098179 X:122620471-122620493 CAGGTACACCAATTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197098179 Original CRISPR CAGGTACACCAATTAAATGT AGG Intergenic
No off target data available for this crispr