ID: 1197099676

View in Genome Browser
Species Human (GRCh38)
Location X:122637407-122637429
Sequence AGGGAGAGCGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197099676_1197099683 25 Left 1197099676 X:122637407-122637429 CCCACAGTCACTGCGCTCTCCCT No data
Right 1197099683 X:122637455-122637477 CATGCCATGTGGCCACTGCCAGG 0: 3
1: 8
2: 22
3: 70
4: 310
1197099676_1197099681 14 Left 1197099676 X:122637407-122637429 CCCACAGTCACTGCGCTCTCCCT No data
Right 1197099681 X:122637444-122637466 GATTCTCTCTCCATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197099676 Original CRISPR AGGGAGAGCGCAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr