ID: 1197099681

View in Genome Browser
Species Human (GRCh38)
Location X:122637444-122637466
Sequence GATTCTCTCTCCATGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197099678_1197099681 -5 Left 1197099678 X:122637426-122637448 CCCTCCTCTAAGTGCACAGATTC No data
Right 1197099681 X:122637444-122637466 GATTCTCTCTCCATGCCATGTGG No data
1197099680_1197099681 -9 Left 1197099680 X:122637430-122637452 CCTCTAAGTGCACAGATTCTCTC No data
Right 1197099681 X:122637444-122637466 GATTCTCTCTCCATGCCATGTGG No data
1197099677_1197099681 13 Left 1197099677 X:122637408-122637430 CCACAGTCACTGCGCTCTCCCTC No data
Right 1197099681 X:122637444-122637466 GATTCTCTCTCCATGCCATGTGG No data
1197099679_1197099681 -6 Left 1197099679 X:122637427-122637449 CCTCCTCTAAGTGCACAGATTCT No data
Right 1197099681 X:122637444-122637466 GATTCTCTCTCCATGCCATGTGG No data
1197099676_1197099681 14 Left 1197099676 X:122637407-122637429 CCCACAGTCACTGCGCTCTCCCT No data
Right 1197099681 X:122637444-122637466 GATTCTCTCTCCATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197099681 Original CRISPR GATTCTCTCTCCATGCCATG TGG Intergenic
No off target data available for this crispr