ID: 1197099683

View in Genome Browser
Species Human (GRCh38)
Location X:122637455-122637477
Sequence CATGCCATGTGGCCACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 3, 1: 8, 2: 22, 3: 70, 4: 310}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197099679_1197099683 5 Left 1197099679 X:122637427-122637449 CCTCCTCTAAGTGCACAGATTCT No data
Right 1197099683 X:122637455-122637477 CATGCCATGTGGCCACTGCCAGG 0: 3
1: 8
2: 22
3: 70
4: 310
1197099678_1197099683 6 Left 1197099678 X:122637426-122637448 CCCTCCTCTAAGTGCACAGATTC No data
Right 1197099683 X:122637455-122637477 CATGCCATGTGGCCACTGCCAGG 0: 3
1: 8
2: 22
3: 70
4: 310
1197099676_1197099683 25 Left 1197099676 X:122637407-122637429 CCCACAGTCACTGCGCTCTCCCT No data
Right 1197099683 X:122637455-122637477 CATGCCATGTGGCCACTGCCAGG 0: 3
1: 8
2: 22
3: 70
4: 310
1197099680_1197099683 2 Left 1197099680 X:122637430-122637452 CCTCTAAGTGCACAGATTCTCTC No data
Right 1197099683 X:122637455-122637477 CATGCCATGTGGCCACTGCCAGG 0: 3
1: 8
2: 22
3: 70
4: 310
1197099677_1197099683 24 Left 1197099677 X:122637408-122637430 CCACAGTCACTGCGCTCTCCCTC No data
Right 1197099683 X:122637455-122637477 CATGCCATGTGGCCACTGCCAGG 0: 3
1: 8
2: 22
3: 70
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197099683 Original CRISPR CATGCCATGTGGCCACTGCC AGG Intergenic
901303098 1:8213835-8213857 CATGGCATTTAGCCAGTGCCTGG - Intergenic
901931858 1:12601083-12601105 CATGCCACGTGGAAACAGCCAGG - Intronic
902143658 1:14378533-14378555 CATGCCATGCGGTCACTACCAGG - Intergenic
902184257 1:14713296-14713318 CAAGTCATGTGGCCACGTCCAGG + Intronic
902516753 1:16993700-16993722 CATGGCAGGTGGCCAGTGCTCGG + Exonic
902953634 1:19908497-19908519 CATGCCATCTCCCCACTGTCAGG - Exonic
906837387 1:49098656-49098678 CATGTCATTAGGCCAGTGCCAGG - Intronic
907916457 1:58874334-58874356 CATACCAGGTACCCACTGCCTGG - Intergenic
907945043 1:59128289-59128311 AATGTCATGTGGCCACCCCCAGG + Intergenic
908255511 1:62300201-62300223 CATGCCTTGTGGCCAGTGAAGGG - Intronic
908959028 1:69671854-69671876 CATGCCATGTGGCCGCTGCTGGG + Intronic
909155003 1:72062834-72062856 AATGCCATGTGGGCAGTCCCTGG - Intronic
909270851 1:73621721-73621743 CATACCATGTAGCTGCTGCCAGG + Intergenic
909902967 1:81160874-81160896 TGTGCCATGTGGCCACTGCTGGG - Intergenic
910349430 1:86278358-86278380 CATGCCATGCAGCAGCTGCCAGG + Intergenic
912633380 1:111268348-111268370 CGCACCATGTAGCCACTGCCAGG + Intergenic
912725955 1:112059033-112059055 CATCCCATGTGGTTCCTGCCTGG + Intergenic
915632921 1:157165995-157166017 CATGCCCTTTGGCCTCAGCCTGG + Intergenic
916360464 1:163962080-163962102 CACACTATGTGGCCACTCCCAGG - Intergenic
916369481 1:164074191-164074213 CATACCAGGCTGCCACTGCCTGG + Intergenic
917387388 1:174491929-174491951 CTTGCCATGCAGCCACTGCTGGG + Intronic
917746953 1:178019120-178019142 CATGACAAGTGGCCAAGGCCTGG + Intergenic
918097461 1:181346844-181346866 CCTGCCTTGGGGCCACTGCTTGG + Intergenic
918270201 1:182891068-182891090 TGCGCCATGTGGCCGCTGCCAGG - Intergenic
918357885 1:183723461-183723483 TTTGCTATGCGGCCACTGCCAGG - Intronic
918476327 1:184928676-184928698 TGTGCCATGCGACCACTGCCAGG + Intronic
919067655 1:192713850-192713872 CATGCTACATGGCCACTGCTGGG - Intergenic
919257601 1:195143448-195143470 TATGCCACATGGCTACTGCCAGG + Intergenic
920192222 1:204201053-204201075 CATGATGTGTGGCCACTGTCAGG - Intronic
920255187 1:204649851-204649873 CACGCCAGGTTGCCTCTGCCTGG - Intronic
920494548 1:206445394-206445416 CATGCCATTTGGCTTCTGCTCGG - Intronic
921002134 1:211055209-211055231 CATGCCAAGTGGCCATTGCTGGG - Intronic
922471091 1:225877758-225877780 CATTCTCTGTGGACACTGCCAGG - Intronic
922575034 1:226655633-226655655 CAGGGCAAGTGGCCACTGACTGG - Intronic
923015198 1:230121117-230121139 TATGCCATTTGGACACTGGCTGG - Intronic
1062939325 10:1409832-1409854 CATTCCCTGTGACCACGGCCAGG - Intronic
1063176877 10:3558910-3558932 CGTGCAATGTGGCCACTCCCGGG - Intergenic
1064446458 10:15398304-15398326 TGTGCAGTGTGGCCACTGCCAGG - Intergenic
1065431566 10:25662101-25662123 TATGCCATGTGGCTGCTGCCAGG + Intergenic
1066287663 10:33983883-33983905 CATAGAATGTGGGCACTGCCAGG + Intergenic
1067225916 10:44375506-44375528 CTGGCCAGGTGGCCACAGCCTGG + Intronic
1067287327 10:44916071-44916093 CTGGCCATGTGACCTCTGCCAGG - Intronic
1067296245 10:44976677-44976699 CATGCCATGAGGCCCCTGTGTGG + Exonic
1068226062 10:54108280-54108302 CTTGCCATGTGTCTTCTGCCAGG - Intronic
1068562273 10:58528147-58528169 CATTCCATGAGGTCAATGCCAGG - Intronic
1068628552 10:59275439-59275461 CATGCCATCTGGTCACTTCCAGG + Intronic
1069569598 10:69486311-69486333 CATTCTCTGTGTCCACTGCCTGG + Intronic
1069834676 10:71301115-71301137 CATGCCCTAGGGTCACTGCCTGG - Exonic
1071106907 10:82108826-82108848 AGTACCATGTGGCCACAGCCTGG + Intronic
1075496253 10:122922115-122922137 CATACCATGTAGCCACTGCAAGG - Intergenic
1075577458 10:123588435-123588457 CATGGCATGTGCACACTGCCTGG - Intergenic
1075590202 10:123685507-123685529 GCTGCCACGTGGCCACTGGCGGG - Intronic
1076260008 10:129057926-129057948 CTTGCCATCTGGCCTCTGCTTGG - Intergenic
1076653252 10:132004334-132004356 GATGCCCTGTGGCCACTCCAAGG - Intergenic
1077187316 11:1241167-1241189 CGTGCCCTGTGGCCCCTCCCCGG + Exonic
1077249377 11:1554279-1554301 CCTCCCACCTGGCCACTGCCTGG - Exonic
1077329870 11:1979529-1979551 CAAGCCAGGTGGCCACAGCACGG + Intronic
1079094645 11:17502544-17502566 CATTACATGAGGACACTGCCAGG - Intronic
1079801994 11:24880297-24880319 CACGCCATGAGGCTGCTGCCAGG + Intronic
1080350994 11:31385896-31385918 CACGCCATGTGGCCACTGCAGGG - Intronic
1080489970 11:32751632-32751654 CACATCATGTGGCCACTGCAGGG + Intronic
1080707259 11:34707989-34708011 TATGCCATGTGGCCACTGCCAGG + Intergenic
1080875914 11:36274143-36274165 CATGCTCTGTGGGCTCTGCCTGG + Exonic
1081049066 11:38315155-38315177 CATGCCATGTGACCACTGCTGGG - Intergenic
1081659732 11:44880667-44880689 CATGTTATGTGGCCAGGGCCAGG + Intronic
1081714128 11:45236474-45236496 GATGCCATGAGCCCCCTGCCTGG + Intergenic
1082800490 11:57410568-57410590 CATGCCTTTTAACCACTGCCTGG - Intronic
1083323528 11:61862081-61862103 CATGGCCTGTTCCCACTGCCAGG - Intronic
1084410815 11:69005069-69005091 CAGACCCTGTGGCCCCTGCCCGG - Exonic
1084763970 11:71295449-71295471 CATGCCACGCGGCTGCTGCCAGG + Intergenic
1085444061 11:76589134-76589156 CCTGCCCTGCAGCCACTGCCAGG - Intergenic
1085562653 11:77486584-77486606 CATGCCATGTGGCCACTGCCAGG - Intergenic
1087032145 11:93716330-93716352 CGCACCATGTGGCCACTGCCTGG + Intronic
1087349985 11:97019511-97019533 CATGCCATGTGGCCACCGCTGGG - Intergenic
1087691153 11:101321593-101321615 GCTGCCATGTGGTCACTTCCTGG + Intergenic
1087824503 11:102749612-102749634 CATGCCATATGATCACTGCAGGG + Intergenic
1088411592 11:109540044-109540066 CATACCATGTGGCCACTGCCAGG + Intergenic
1089257247 11:117200428-117200450 CCTGCCCTGTGGCTCCTGCCAGG - Intronic
1090221062 11:125026401-125026423 CATGCCATGTGGCTTCTGTTGGG + Intronic
1091051114 11:132373566-132373588 CACACCACATGGCCACTGCCAGG - Intergenic
1091099988 11:132863111-132863133 CATGCCATGTAGCTACAGGCAGG - Intronic
1202812848 11_KI270721v1_random:34708-34730 CAAGCCAGGTGGCCACAGCACGG + Intergenic
1091690401 12:2592579-2592601 CATTAAATGTGGCCACTGGCTGG + Intronic
1091831811 12:3555462-3555484 CATGCCGTGTGGCCAGGGCATGG + Intronic
1093124160 12:15307845-15307867 CATGCCATGCTGCCACTTCCAGG + Intronic
1093619881 12:21276690-21276712 CATGCCATGTGGCCACTGCTGGG - Intronic
1093788812 12:23222983-23223005 CATGTCATGTGGTTACAGCCAGG + Intergenic
1094525654 12:31229128-31229150 CATGCCTTCTGTCCAATGCCTGG - Intergenic
1095624991 12:44304149-44304171 TGTGCCACGTGGCCACTGCTGGG - Intronic
1097161465 12:57049210-57049232 CCTGCCATGTGCCTACTGCATGG - Intronic
1097899396 12:64857947-64857969 CATGTCTTATGGCCACTGCCAGG + Intronic
1098770172 12:74541232-74541254 CATGCCCAGGGACCACTGCCTGG + Exonic
1099101021 12:78440142-78440164 CATGCCATGCCGCTACTGCTGGG + Intergenic
1099969855 12:89489668-89489690 CATGCCAGGTGTCCCCAGCCAGG - Intronic
1103461249 12:121106850-121106872 TGTGCCACATGGCCACTGCCAGG - Intergenic
1103728270 12:123009816-123009838 CATGCCAGGTGGGCAGTGGCTGG - Intronic
1104923176 12:132301624-132301646 CATGCCATGTGGACACATTCAGG + Intronic
1106350103 13:28921880-28921902 CACACCATGCAGCCACTGCCAGG + Intronic
1107178547 13:37428789-37428811 CATGGCATGTGGCCACCTCAGGG - Intergenic
1108111123 13:47073824-47073846 CATGCCATTTAGCCATTGCTGGG - Intergenic
1108137830 13:47384977-47384999 TGTGCCATGTGGCTGCTGCCAGG - Intergenic
1108456650 13:50621993-50622015 CAGGCAATATGGCCAGTGCCAGG - Intronic
1109506633 13:63311040-63311062 CTTTCCACGCGGCCACTGCCAGG - Intergenic
1110665881 13:78116818-78116840 TGTGCCATATGGCCGCTGCCAGG + Intergenic
1110974078 13:81807687-81807709 CATGCCATGCAGCCACTGCTGGG - Intergenic
1111572192 13:90103621-90103643 TGTGCCATATGGCCACTGCTGGG + Intergenic
1113244437 13:108378301-108378323 CATGCCACGTGGCTGCTACCAGG + Intergenic
1114610641 14:24037824-24037846 CCTGCAGCGTGGCCACTGCCTGG - Intergenic
1117070483 14:52051499-52051521 CCAGCCATGTGGCATCTGCCTGG - Intronic
1117110257 14:52446214-52446236 CATGCAGTGTGGCCACTGCCAGG - Intronic
1117161626 14:52995389-52995411 TGCACCATGTGGCCACTGCCAGG + Intergenic
1117607115 14:57441003-57441025 TATGCCATGTGGCTACTGCTGGG + Intergenic
1117843146 14:59881554-59881576 TACGCCGTGTGGCCACTCCCAGG + Intergenic
1118084546 14:62399532-62399554 CACACCACATGGCCACTGCCAGG + Intergenic
1118096796 14:62546330-62546352 TGTGCCATGTGGCCACTGCCAGG - Intergenic
1119261843 14:73242310-73242332 CCTGCCATGGAGCCACAGCCTGG - Intronic
1119944145 14:78674026-78674048 GCTGCCATGTGGCCACTGGGTGG - Intronic
1121605988 14:95240436-95240458 CATGCCTCGTGACCACTGCATGG + Intronic
1122236059 14:100331198-100331220 TATGCCCTGTGCCCTCTGCCAGG + Intergenic
1122955166 14:105067054-105067076 CATGCCTTCTGGCCTTTGCCAGG + Intergenic
1123502460 15:20902417-20902439 CATAGCATGTGACTACTGCCAGG - Intergenic
1123559710 15:21476084-21476106 CATAGCATGTGACTACTGCCAGG - Intergenic
1123595944 15:21913383-21913405 CATAGCATGTGACTACTGCCAGG - Intergenic
1124249122 15:28096013-28096035 CATGCCCTGTGGACCCAGCCAGG - Intronic
1126015564 15:44347365-44347387 CATGCCACAAGGCCACTGCAGGG - Intronic
1126232710 15:46345575-46345597 GCTGCCATGTGGCCACTACATGG - Intergenic
1126572291 15:50164948-50164970 CATGCCATAAGGCTTCTGCCAGG + Intronic
1126660839 15:51031518-51031540 CATGCCACGTGGCCAGTGCTGGG + Intergenic
1127132519 15:55882320-55882342 CATGCCATACAGCCACTGCCAGG - Intronic
1127794550 15:62426756-62426778 CCTGCCTTGTGGCCAGTGCTGGG + Intronic
1129878084 15:78990037-78990059 CTTGCCATGTGGCCTCGGGCTGG - Intronic
1129920123 15:79312426-79312448 GATGTCATCTGGTCACTGCCAGG + Intronic
1130149991 15:81304135-81304157 CATGCCAGATTGCCACTGCAAGG - Intronic
1130441268 15:83956265-83956287 CGTGCCATGCAGCCACTGCCAGG + Intronic
1130933499 15:88449463-88449485 CATGCCATGTGGGGTTTGCCTGG - Intergenic
1131149111 15:90035913-90035935 CATGCAATGGTGCCACTGCCTGG - Intronic
1131248544 15:90816585-90816607 GAAGCCGTGTGGCCTCTGCCTGG + Intergenic
1131315245 15:91329810-91329832 CACGCCATGTGGTCACTGCTGGG + Intergenic
1202968052 15_KI270727v1_random:203246-203268 CATAGCATGTGACTACTGCCAGG - Intergenic
1132934154 16:2472588-2472610 CATGGCAGCGGGCCACTGCCCGG + Exonic
1133337231 16:5014193-5014215 CAGCCCATGTGGCCAGTGGCTGG + Intronic
1134453651 16:14378755-14378777 CCTGCCCTGTGGCCTCAGCCAGG - Intergenic
1136654984 16:31704171-31704193 CCTACCATGTGGCCTCTGACCGG + Intergenic
1137577374 16:49609189-49609211 GATGCCATCTTGCTACTGCCAGG - Intronic
1138890849 16:61142510-61142532 CCTGTCACGTGGCCACTGCTGGG + Intergenic
1139835935 16:69838618-69838640 CTTCCCAAGTGGCCACTCCCAGG + Intronic
1140309014 16:73831305-73831327 CAGGCCATGTGTCCACTCCGAGG + Intergenic
1140567076 16:76056004-76056026 CACACCATGTGGCTGCTGCCAGG + Intergenic
1141141503 16:81499649-81499671 GCTGGCATGTGGCCTCTGCCCGG + Intronic
1142141617 16:88475240-88475262 CCTGCCAGGTGCCCACTGCATGG - Intronic
1142685724 17:1575936-1575958 CAGGCCATGTGGCCACCCTCAGG + Intronic
1142834735 17:2576672-2576694 CATGCCATGCAGCCATGGCCAGG + Intergenic
1143102960 17:4514212-4514234 CATGCTGTGTGGCCCCAGCCTGG + Intronic
1144428819 17:15171635-15171657 CATGCCATGTGTGCAGTACCAGG - Intergenic
1145249613 17:21289957-21289979 CCTGCCATGTGGCCCATGGCCGG + Intronic
1146242688 17:31244662-31244684 CACACCACGGGGCCACTGCCAGG + Intronic
1146686298 17:34843786-34843808 CTTCCCATGTGGCCCCTGCATGG - Intergenic
1148846510 17:50533010-50533032 CCTTCCATGCCGCCACTGCCAGG - Intronic
1149231172 17:54536352-54536374 CATGCCATGCAGCCAAAGCCAGG - Intergenic
1150541384 17:66103776-66103798 CATGCCATGTAGCCACTGCTGGG - Intronic
1151939951 17:77286250-77286272 CAGGGCAGGTGGCCCCTGCCTGG - Intronic
1152370714 17:79886938-79886960 CCTGCCTTGGGGCCTCTGCCTGG - Intergenic
1152737220 17:82003493-82003515 CCAGCCATGTGGCCACTCGCTGG + Intronic
1152848669 17:82618301-82618323 CATGCCCTGTGGCCACGGCCAGG - Intronic
1152854912 17:82659204-82659226 CACGCCATGTCACCATTGCCAGG + Intronic
1156094148 18:33509565-33509587 TGTGCCATGGGGCCACTGCCTGG - Intergenic
1158217501 18:55115492-55115514 CATGCCATGAGGTCTCTGCCTGG + Intergenic
1159092148 18:63861332-63861354 CCTGCCATGTGGCCCCTGCTGGG + Intergenic
1159285046 18:66337602-66337624 TATGCCATGCGACCACTGCCAGG + Intergenic
1159490668 18:69129564-69129586 CATGCTATGTGGCCACCACCAGG + Intergenic
1159802688 18:72920443-72920465 CACACCACATGGCCACTGCCAGG + Intergenic
1159982651 18:74804372-74804394 CATGCCATGTGACAAATGCCTGG + Intronic
1160507108 18:79433393-79433415 CGTGACCTGTGGCCACGGCCCGG - Intronic
1160988404 19:1850793-1850815 CATGGCCTGTGCCCTCTGCCCGG - Intergenic
1163703572 19:18799295-18799317 CATGCTGTATGGGCACTGCCAGG + Intergenic
1165467543 19:35983936-35983958 CATCTCTTGTGTCCACTGCCTGG + Intergenic
1168565476 19:57418754-57418776 CATGCGGTGTGGCCACTGGCAGG - Intronic
925178359 2:1800457-1800479 CAGGCCATGTGGCTGCTGCCTGG - Intronic
925306216 2:2849522-2849544 CAGGCCGGGTGGACACTGCCAGG + Intergenic
925797724 2:7564981-7565003 CATGCCATGTTCCCTCTGCCAGG + Intergenic
927202850 2:20589227-20589249 CACTCCTTGTGGTCACTGCCAGG + Intronic
927913683 2:26919778-26919800 CATTCTAGGTGGACACTGCCAGG - Intronic
930041652 2:47129631-47129653 CATGCCACGTGGCTGCTGCCAGG + Intronic
930469153 2:51791795-51791817 TGTGCCATGTGACTACTGCCAGG - Intergenic
930878416 2:56245398-56245420 CATGCCACATGGCCTCTGCCAGG + Intronic
933514165 2:83279471-83279493 CCTGCCACGTGGCTACTGGCTGG + Intergenic
934553059 2:95274052-95274074 CATGCCCGGTGCCCACTGCCAGG - Intergenic
934777299 2:96947582-96947604 CAGCCCCTGTGGCCACGGCCAGG - Intronic
935373821 2:102375204-102375226 CATCCCATGTGGTCCCTGCATGG + Intronic
935835681 2:107050678-107050700 CATGCCACATTGCCACTACCAGG + Intergenic
936032920 2:109086652-109086674 CATTCCATAAGGCCCCTGCCAGG + Intergenic
937052717 2:118905455-118905477 CATGCCAGGTGGCCAGGCCCTGG - Intergenic
938083795 2:128385127-128385149 CTTGCCAGGTGGCCACACCCAGG + Intergenic
939405192 2:141746497-141746519 CATGCCACGTGGCTGCTGCTGGG + Intronic
939708032 2:145479229-145479251 TATGCCATATGGCTGCTGCCAGG + Intergenic
941479464 2:165988326-165988348 CATGCCATCTGTCTCCTGCCTGG - Intergenic
942391902 2:175503412-175503434 CATGCCATGTAGCTGCTGCTGGG + Intergenic
942862674 2:180635332-180635354 TGTGCCATGCGGCCACTGCTAGG - Intergenic
945711848 2:213306801-213306823 CATGCCACTTGGCCACTGCCAGG + Intronic
945771152 2:214044681-214044703 CATCCCATGTGGCCTCTGCCAGG - Intronic
946147826 2:217744197-217744219 CACACCATGTGGGGACTGCCAGG + Intronic
947009281 2:225547660-225547682 CATGCCATGTGGCCACTGCTGGG + Intronic
947550418 2:231041569-231041591 GAGCCCATGTGCCCACTGCCTGG - Intronic
1168917416 20:1501449-1501471 CACACCATGCTGCCACTGCCAGG + Intergenic
1169597172 20:7213823-7213845 CATGCCATGTGGCCTCTGCGAGG - Intergenic
1170709369 20:18776175-18776197 CGCACCATGTGGCTACTGCCAGG + Intergenic
1170768912 20:19315289-19315311 CCTACCCTGGGGCCACTGCCAGG - Intronic
1170864228 20:20138551-20138573 CACGCCACGTGGCTACTGCCAGG + Intronic
1172253460 20:33496315-33496337 TTTGCCATCTGGCCCCTGCCAGG - Intronic
1172685435 20:36750378-36750400 CATGCCATGGCACTACTGCCTGG + Intergenic
1172975166 20:38900617-38900639 CATGCCATATGACCTCTGCGAGG + Exonic
1173768480 20:45636092-45636114 CTCTCCATGTGGCCACTGGCAGG - Intergenic
1174695417 20:52551875-52551897 AATGCCATGTGGCCACTGTGGGG + Intergenic
1175305421 20:57972666-57972688 GATGCCATCTGGACACAGCCAGG - Intergenic
1176146689 20:63568620-63568642 CAGGCAGTGTGTCCACTGCCTGG + Exonic
1176202673 20:63869630-63869652 CATGCCCTGTCTCCACTGCCAGG - Intronic
1177692689 21:24531842-24531864 CATGTAATGGGGCCACTGCTGGG - Intergenic
1178470940 21:32892047-32892069 TGTGCCATGTGGCCTCTGCATGG - Intergenic
1178764736 21:35439752-35439774 CCTGCTCTGTGTCCACTGCCGGG - Intronic
1179725164 21:43337901-43337923 CCTGCCAGGTGGCCCCTCCCCGG + Intergenic
1182086539 22:27565015-27565037 CATGCCCTGTGCCCATTGACAGG + Intergenic
1182201719 22:28578698-28578720 CATGCTACGTGGGCACTGCCAGG - Intronic
1183932000 22:41240687-41240709 GTGGCAATGTGGCCACTGCCAGG - Intronic
1184430173 22:44437904-44437926 CACGCCATGTGACCCCAGCCAGG - Intergenic
1184652521 22:45925690-45925712 CAGGCCGTGTGGCCAGGGCCAGG - Intronic
1184712098 22:46257042-46257064 AATGCCATGTGGCAGATGCCAGG + Exonic
950477466 3:13223119-13223141 GCTGCCATGTGCCCACTGGCCGG - Intergenic
951279675 3:20732390-20732412 CATGCCATGTGACCTCTACTGGG + Intergenic
951310377 3:21117847-21117869 CATGCCACGTGGCTGCTGCAGGG + Intergenic
951711131 3:25585700-25585722 CATGCCATCTTGCCTCTGCCGGG + Intronic
952740586 3:36730295-36730317 CATGCCATGTGACAAGTCCCAGG - Intronic
952932601 3:38371778-38371800 TATGCCATGAGGCCAGTGCATGG + Intronic
953390809 3:42532639-42532661 CATACCATGTGCCCAGTCCCTGG + Intronic
953966455 3:47310885-47310907 CCAGCCATGAGACCACTGCCTGG - Intronic
955090403 3:55744674-55744696 CAGGCCCTGTAGCCACTGCTTGG + Intronic
955274501 3:57534213-57534235 CATGCCATGCAGCCACTGCTGGG + Intronic
956479457 3:69659499-69659521 CATGCCATGTTGCCTCTGTGCGG + Intergenic
957485582 3:80858365-80858387 CATGCCATGTGGCCACTAAGAGG - Intergenic
958457271 3:94347670-94347692 CTTGCCATGTAGCCAGTGTCTGG - Intergenic
958631308 3:96686629-96686651 TGCACCATGTGGCCACTGCCAGG + Intergenic
959404244 3:105940885-105940907 CATGCCACGTAGCCTCTGACAGG + Intergenic
959409160 3:105998447-105998469 TATACCATGTGGTCACTGCCAGG + Intergenic
959632141 3:108518693-108518715 CACGTCATGTGACCCCTGCCGGG + Intronic
959674540 3:109019959-109019981 TATACCATGTGGTCACTGCAGGG - Intronic
959806719 3:110562899-110562921 CATGCCAGGCAGCCAGTGCCAGG + Intergenic
960564805 3:119122201-119122223 CATGCCATGTAGCTGCTGCCAGG - Intronic
962015031 3:131430899-131430921 CACATCACGTGGCCACTGCCAGG - Intergenic
962078833 3:132115241-132115263 TGTGCCACATGGCCACTGCCAGG + Intronic
962461948 3:135622165-135622187 CATGCCATGTGCCCAGTACTGGG - Intergenic
963572038 3:147009425-147009447 CTTGTCATGAGGCCACTGCCAGG + Intergenic
964151554 3:153531705-153531727 TGTGCCACTTGGCCACTGCCAGG - Intergenic
964179278 3:153864656-153864678 CATGCCTTGTGGCTGCTGCTGGG - Intergenic
965175352 3:165323239-165323261 CACACCATGTGGTCACTGCTGGG + Intergenic
965256975 3:166425703-166425725 CATGCCATGTGGCTGCTGCCAGG - Intergenic
965547960 3:169934567-169934589 CATACCATGTGGTCACTTCTGGG - Intronic
966676832 3:182598911-182598933 AATGCTATTTGGCCACTGGCTGG - Intergenic
967407252 3:189130988-189131010 CATGCCATGTTACCTCTGGCCGG + Intronic
968005302 3:195238493-195238515 CCTGTCATGTGGCCAGTGGCTGG - Intronic
968284826 3:197502366-197502388 CAGGCCATCTGGCCTTTGCCAGG + Intergenic
968334219 3:197899918-197899940 CGTGCCGTGTGGCTGCTGCCAGG - Intronic
969337959 4:6522657-6522679 CGTGCCCTGTGGCCACTTCTGGG - Intronic
969352206 4:6604376-6604398 CCTTCCCTGTGGCCTCTGCCTGG - Intronic
969620030 4:8274227-8274249 CACGCAATGTGCCCACTGCCCGG + Intronic
970098084 4:12487495-12487517 TGTGCCACGTGGCCACTACCGGG + Intergenic
971758954 4:30738897-30738919 CATGGCATATGGAAACTGCCAGG + Intronic
971914676 4:32852054-32852076 TGTGCCATGTGGCCATTGCTGGG + Intergenic
973846486 4:54918037-54918059 CACAGCATCTGGCCACTGCCAGG - Intergenic
974533015 4:63136363-63136385 CATGGGATATGGCTACTGCCAGG - Intergenic
975295131 4:72726076-72726098 TGTGCCAGATGGCCACTGCCAGG - Intergenic
976082949 4:81376077-81376099 CATGACATGCAGCCACTGCCAGG + Intergenic
976151785 4:82099694-82099716 CCTGCCTTCTGGCCTCTGCCTGG - Intergenic
977527949 4:98166921-98166943 CTTGCCATGAAGCTACTGCCAGG + Intergenic
979111260 4:116761104-116761126 CATGCCATGAGGCTCTTGCCAGG - Intergenic
980956512 4:139434071-139434093 TGTGCCACGTGGCCACTGCTGGG + Intergenic
981530919 4:145752989-145753011 CGTGCCACGTGGCCGCTGCTGGG + Intronic
982123147 4:152161134-152161156 AATGCCAGGTCACCACTGCCAGG - Intergenic
983878618 4:172906730-172906752 CTTGCCATGTGGCCCCCTCCAGG + Intronic
986155919 5:5175859-5175881 TGTGCCATGTGGCCACTGCCAGG + Intronic
986631313 5:9776294-9776316 CATGCCACATGCCCACTGCCAGG + Intergenic
987631353 5:20477427-20477449 CACATTATGTGGCCACTGCCAGG - Intronic
987903769 5:24049980-24050002 CATGCCATGCAGCCATTGCTAGG - Intronic
988464646 5:31476757-31476779 CATGCCCTGTGGGCTCTGGCAGG - Intronic
989502360 5:42182758-42182780 CATGCCACATGGCTGCTGCCAGG - Intergenic
991209256 5:64085258-64085280 CATGCAATGTAGCCAGTGCCAGG + Intergenic
991237570 5:64417451-64417473 CATGCCAAATGGCTGCTGCCAGG - Intergenic
992934408 5:81687147-81687169 CGTACCATGCGGCCGCTGCCGGG - Intronic
993246363 5:85458498-85458520 CATGCCACGGGGACCCTGCCTGG + Intergenic
995019725 5:107352910-107352932 CATGCCATGCGGCCACTGCCAGG + Intergenic
996548224 5:124703722-124703744 CATGCCATGGCGCTACAGCCTGG + Intronic
996956285 5:129187055-129187077 CAAACCATGCAGCCACTGCCGGG - Intergenic
997111320 5:131078086-131078108 CAAGCCATGTGGTCACAACCAGG + Intergenic
997145948 5:131433372-131433394 CAAGCCAAGTGGCCACTGCAAGG - Intronic
997454737 5:134008059-134008081 TGGGCCATGTGGCCACTCCCAGG - Intergenic
997614080 5:135234535-135234557 CTTGCCATGTGGCAACTTGCTGG + Intronic
998133460 5:139662569-139662591 CATGCCCTTTGACCACTGCTAGG - Intronic
998524747 5:142832080-142832102 CATCCCTTGTGTCCACTGACAGG - Intronic
999153174 5:149440298-149440320 CATGCTATGTGACCTCTGGCAGG - Intergenic
999849609 5:155523948-155523970 CATGCCACTTGGCCACTGCTGGG + Intergenic
999919940 5:156306596-156306618 CATGCCATATGGCCATTCCTAGG + Intronic
1001608570 5:172981894-172981916 AATGCAATGTGGCTACTGCAAGG + Intergenic
1002586455 5:180251915-180251937 CATGACAGGTGTCCACTGTCTGG + Intronic
1002689615 5:181041260-181041282 CGTGGCCTGTGGACACTGCCAGG + Intronic
1002964227 6:1946698-1946720 CATGCCCTGTGATCACTTCCTGG - Intronic
1004427080 6:15513805-15513827 CATTCCCTGTGGCCTGTGCCTGG + Intronic
1005037535 6:21570400-21570422 TGTGCCATGTGGCCACTGCTGGG + Intergenic
1006554383 6:34853011-34853033 TGTGCCATGAGGCCACTGCCAGG + Intronic
1007190472 6:40012194-40012216 CATGCCATGTGGCTGCTGCCAGG + Intergenic
1007790983 6:44308131-44308153 CATGCCCTGTGGTCCTTGCCTGG + Intronic
1008848691 6:55997762-55997784 CATGCCATGCAGCTGCTGCCAGG + Intergenic
1009375381 6:62961760-62961782 TATGCCACATGGCCACTGCCAGG + Intergenic
1010560427 6:77341884-77341906 CATGCCACATGGCTGCTGCCAGG + Intergenic
1010596396 6:77769151-77769173 TGTGCCATATGGCCGCTGCCAGG - Intronic
1012073864 6:94658226-94658248 TACACCATGTGGCCACTGCAAGG + Intergenic
1012440177 6:99255083-99255105 CATGCCAACAGGCCACTGACCGG + Intergenic
1013210875 6:107985726-107985748 CATGCCACGTGGACAGCGCCTGG + Intergenic
1013908444 6:115245888-115245910 TGTGCCCTGTAGCCACTGCCAGG - Intergenic
1014840911 6:126219051-126219073 CGTGCCATGTGGCCGCTGCCAGG + Intergenic
1015907167 6:138129229-138129251 CACCCCACGTAGCCACTGCCAGG - Intergenic
1016054849 6:139567568-139567590 TGTGCCATGCAGCCACTGCCAGG + Intergenic
1017243565 6:152197111-152197133 CGTGCCATGTGGCTGCTGCTGGG + Intronic
1017702393 6:157088107-157088129 CCTGCCCAGTGGTCACTGCCAGG + Intronic
1017722707 6:157255171-157255193 GAAGGCATGTGGCCACTTCCAGG + Intergenic
1018576375 6:165264278-165264300 CATGCCATGTGGCCTCTGAGTGG - Intergenic
1019468230 7:1202198-1202220 CATGCCACATGGCCACCTCCAGG - Intergenic
1019858731 7:3636513-3636535 CATGCTATGTAGCAAATGCCAGG + Intronic
1021884992 7:25129480-25129502 TATGCCATGTGGCCACTGCTGGG + Intergenic
1022269516 7:28792815-28792837 GATGCCATTTGTCCACTGCCTGG - Intronic
1022442631 7:30446555-30446577 CAAGGTATGTGGCCACTGTCAGG + Intronic
1027604758 7:80287256-80287278 CATGCCATGCAGCCACTGCCAGG - Intergenic
1028022310 7:85792046-85792068 AGTGCCATGTGGTCACTGCTGGG - Intergenic
1029925252 7:104308936-104308958 CATCCCATGTGGAAACAGCCTGG + Intergenic
1030300268 7:107967486-107967508 CAAGCCATGATGCCTCTGCCTGG + Intronic
1030665509 7:112273404-112273426 CAGGCCACATGGCCACTGCTGGG + Intronic
1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG + Intergenic
1034126275 7:148674777-148674799 CATGCCCTGTGGCCACTGCCAGG - Intergenic
1034398008 7:150842041-150842063 TGTGCCATGTAGCCACTGCCAGG - Intronic
1034888712 7:154820133-154820155 GAAGCCATGTGTCCACAGCCTGG + Intronic
1035577789 8:719088-719110 CAGGCCCTGGGGCCACTGCCTGG + Intronic
1035583082 8:752472-752494 CCTGCCATCAGGCCTCTGCCTGG - Intergenic
1036654530 8:10669392-10669414 CATGCCATGTGGCTTTTGCATGG + Intronic
1038066448 8:23968413-23968435 AATGTCTTGTGGCCTCTGCCTGG + Intergenic
1039889240 8:41673078-41673100 CAGGCCTTGTGGCTGCTGCCTGG + Intronic
1039985696 8:42445820-42445842 GCTGCCATCTGGACACTGCCTGG + Intronic
1041606817 8:59791987-59792009 CATGCTATGAGACCACTGCAAGG - Intergenic
1044493053 8:92843767-92843789 CATGCCATGTGGGTATTCCCAGG + Intergenic
1045364078 8:101459578-101459600 CATGGCATGCAGCCACTTCCTGG + Intergenic
1046750178 8:117918748-117918770 CATTCCATGTGGCATCTGCTGGG - Intronic
1047342939 8:124000224-124000246 CACACCATTTGGCCACTGCTAGG + Intronic
1047352549 8:124089359-124089381 CATGCTACAGGGCCACTGCCAGG + Intronic
1047841074 8:128754100-128754122 TATGCCATATAGTCACTGCCTGG - Intergenic
1048118666 8:131554771-131554793 CACGCCAGGAGGCCACTGCCAGG - Intergenic
1049238842 8:141526298-141526320 CATGCCCTGTGCCCAGTCCCAGG + Intergenic
1050527495 9:6558626-6558648 CCTGCCATGTGGGCACTTGCTGG + Exonic
1051375398 9:16397187-16397209 GATGTCATTTGTCCACTGCCTGG - Intergenic
1051464933 9:17367143-17367165 CATGTCACATGGCCACTGCCAGG - Intronic
1051842465 9:21414031-21414053 CATGCCATGTGGCTGCTGCTAGG + Intronic
1052450610 9:28625332-28625354 CAAGCCATGTGGCCACTGCCAGG + Intronic
1053474456 9:38372041-38372063 CATGCTATGTGACCACAGACTGG + Intergenic
1054720968 9:68603440-68603462 CATGGCCTGTGCCCTCTGCCTGG + Intergenic
1054985503 9:71257473-71257495 CATGCCATGTACCCAATGACTGG + Intronic
1055394194 9:75856314-75856336 CTTACCAAATGGCCACTGCCAGG + Intergenic
1055826905 9:80338461-80338483 CATGCCATGTGGCTGCTGCCAGG - Intergenic
1056230702 9:84539776-84539798 CATGCCATGTGGCCACTAACAGG + Intergenic
1056397695 9:86196549-86196571 CTTGGCCTGTGTCCACTGCCTGG - Intergenic
1057266444 9:93621053-93621075 CCTGCCAAGTGGCCACTGTCGGG + Intronic
1057289193 9:93789658-93789680 CATGCCACATGACCACTGTCGGG + Intergenic
1057353318 9:94317642-94317664 CATTCCATGTGGCCACAGCAAGG + Intergenic
1057654433 9:96939950-96939972 CATTCCATGTGGCCACAGCAAGG - Intronic
1058249187 9:102669721-102669743 CATGCCATGCAGCCACTGCACGG + Intergenic
1058285373 9:103170113-103170135 CATGACATGTGGCTGCTGCTGGG + Intergenic
1058814998 9:108674926-108674948 TATGGCTTGTGGCCACTGCATGG + Intergenic
1059555610 9:115277179-115277201 CATGCCACATGGCCGCTGCCAGG + Intronic
1060304375 9:122397738-122397760 TGTGCCATGTGGCTGCTGCCAGG - Intergenic
1060929417 9:127479547-127479569 CAAGCCAGGAGGCCACTGGCTGG - Intronic
1061874824 9:133538437-133538459 CAGGCCATGGTGCCCCTGCCCGG - Intronic
1062200381 9:135299784-135299806 CTCGCCATGTGGGCTCTGCCTGG - Intergenic
1062409302 9:136414452-136414474 CGTGCCAGGTGGACAATGCCAGG - Intronic
1185843828 X:3418483-3418505 GATGTCATGTGGCCAATGACGGG - Intergenic
1185868642 X:3644836-3644858 CATGACCTGTGGCCTCTACCTGG - Intronic
1185891761 X:3828284-3828306 CATGTCACGTGGCCACAGCAGGG - Intronic
1185896869 X:3866700-3866722 CATGTCACGTGGCCACAGCAGGG - Intergenic
1185901987 X:3905126-3905148 CATGTCACGTGGCCACAGCAGGG - Intergenic
1188071930 X:25727732-25727754 CACACCATGTGGCCAGTGCCAGG + Intergenic
1188162009 X:26815460-26815482 CATGCCACATGGCCGCTGCAGGG + Intergenic
1188421236 X:29992566-29992588 CATGCCATGAGGCCACTGCCAGG + Intergenic
1188917987 X:35935419-35935441 CATGCCATGCTGCCACTGCTGGG + Intronic
1189192256 X:39120826-39120848 CAGCCCTTGGGGCCACTGCCTGG + Intergenic
1189366396 X:40392269-40392291 TGTGCCATTTTGCCACTGCCTGG + Intergenic
1189985086 X:46546147-46546169 CGGGCCATGTTGCCACTGGCTGG - Intergenic
1192332042 X:70183341-70183363 CATGCCATCTTTCCACTGGCAGG - Intronic
1192374749 X:70548559-70548581 CATGCCATGCAGCCACTGTTGGG - Intronic
1192694355 X:73398931-73398953 CATACCACATGGCCACTGCCAGG - Intergenic
1193183642 X:78486994-78487016 CATGCCAGCAGGCCACTGACTGG - Intergenic
1193246927 X:79239831-79239853 CTTGTCATGTGGCCACTGCCAGG + Intergenic
1193396502 X:80990186-80990208 CATGTCATGTGGCCACTGCAAGG - Intergenic
1193561362 X:83021850-83021872 CATGCCACATGGTCACTGCTGGG - Intergenic
1193563474 X:83048388-83048410 TTTGCCATGTAGCCACTGCTGGG + Intergenic
1194693049 X:97010292-97010314 CATGCCATGTGGCCACTGCCAGG + Intronic
1194882679 X:99273411-99273433 TATGCCATGTGGCCACCGCTAGG - Intergenic
1195090241 X:101451418-101451440 CATGTCATGTGGCTGCTGCCAGG + Intronic
1195543443 X:106088293-106088315 CATTCCATGTGGCCTCTGCTGGG + Intergenic
1195852270 X:109295936-109295958 CATACCACAAGGCCACTGCCAGG + Intergenic
1196963062 X:121025042-121025064 CATGACATGTGGCCTGTACCTGG - Intergenic
1197011470 X:121569926-121569948 CATGCCACGTGGCTGCTGCTGGG - Intergenic
1197099683 X:122637455-122637477 CATGCCATGTGGCCACTGCCAGG + Intergenic
1197382869 X:125766495-125766517 CATGCCACATGGCCACTGCTAGG + Intergenic
1197487862 X:127075509-127075531 TGTGCCACATGGCCACTGCCAGG + Intergenic
1197587361 X:128364654-128364676 TGTGCCATGTGGCCACTATCTGG + Intergenic
1198663301 X:138995121-138995143 CATGCCATGTGACCATTGCTAGG - Intronic
1199314817 X:146364158-146364180 CATGCCACGTGGTCACTGTGAGG + Intergenic
1199457518 X:148045080-148045102 TGTGCCGTGTGACCACTGCCGGG + Intergenic
1200088910 X:153625414-153625436 CTTGCAAAGCGGCCACTGCCCGG + Intergenic
1200110904 X:153740483-153740505 CGTGGCATGTGGACACTGCCTGG + Intronic