ID: 1197100083

View in Genome Browser
Species Human (GRCh38)
Location X:122642440-122642462
Sequence CATGAGTTAGATACCTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197100077_1197100083 0 Left 1197100077 X:122642417-122642439 CCAGGTATTAAAAAGCGTGGAAC No data
Right 1197100083 X:122642440-122642462 CATGAGTTAGATACCTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197100083 Original CRISPR CATGAGTTAGATACCTTGGG GGG Intergenic
No off target data available for this crispr