ID: 1197100093

View in Genome Browser
Species Human (GRCh38)
Location X:122642733-122642755
Sequence CTGAGGCACTGTAACATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197100093_1197100097 3 Left 1197100093 X:122642733-122642755 CCCTAAATGTTACAGTGCCTCAG No data
Right 1197100097 X:122642759-122642781 TTAGTCCATGTACCTCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197100093 Original CRISPR CTGAGGCACTGTAACATTTA GGG (reversed) Intergenic
No off target data available for this crispr