ID: 1197101564

View in Genome Browser
Species Human (GRCh38)
Location X:122662126-122662148
Sequence TTAATGAGTACTACGTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197101559_1197101564 4 Left 1197101559 X:122662099-122662121 CCATGTGTATTTGGAAGAGCCCT No data
Right 1197101564 X:122662126-122662148 TTAATGAGTACTACGTAATGGGG No data
1197101558_1197101564 9 Left 1197101558 X:122662094-122662116 CCTGTCCATGTGTATTTGGAAGA No data
Right 1197101564 X:122662126-122662148 TTAATGAGTACTACGTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197101564 Original CRISPR TTAATGAGTACTACGTAATG GGG Intergenic
No off target data available for this crispr