ID: 1197108861

View in Genome Browser
Species Human (GRCh38)
Location X:122748328-122748350
Sequence CTGTCCAATTGGCTGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197108855_1197108861 3 Left 1197108855 X:122748302-122748324 CCCTTTGGGTTAAGATCCTAAAT No data
Right 1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG No data
1197108850_1197108861 18 Left 1197108850 X:122748287-122748309 CCTCACTCCTAAATCCCCTTTGG No data
Right 1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG No data
1197108856_1197108861 2 Left 1197108856 X:122748303-122748325 CCTTTGGGTTAAGATCCTAAATT No data
Right 1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG No data
1197108854_1197108861 4 Left 1197108854 X:122748301-122748323 CCCCTTTGGGTTAAGATCCTAAA No data
Right 1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG No data
1197108853_1197108861 11 Left 1197108853 X:122748294-122748316 CCTAAATCCCCTTTGGGTTAAGA No data
Right 1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197108861 Original CRISPR CTGTCCAATTGGCTGGTGGC TGG Intergenic
No off target data available for this crispr