ID: 1197119516

View in Genome Browser
Species Human (GRCh38)
Location X:122873761-122873783
Sequence GCAGAGGGAAGGCCTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197119516_1197119520 1 Left 1197119516 X:122873761-122873783 CCTCTTAAAGGCCTTCCCTCTGC No data
Right 1197119520 X:122873785-122873807 GCTACTACTGACTGACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197119516 Original CRISPR GCAGAGGGAAGGCCTTTAAG AGG (reversed) Intergenic
No off target data available for this crispr