ID: 1197119520

View in Genome Browser
Species Human (GRCh38)
Location X:122873785-122873807
Sequence GCTACTACTGACTGACCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197119513_1197119520 28 Left 1197119513 X:122873734-122873756 CCTATCTTTGCACATGTAGCACT No data
Right 1197119520 X:122873785-122873807 GCTACTACTGACTGACCCTGAGG No data
1197119515_1197119520 2 Left 1197119515 X:122873760-122873782 CCCTCTTAAAGGCCTTCCCTCTG No data
Right 1197119520 X:122873785-122873807 GCTACTACTGACTGACCCTGAGG No data
1197119517_1197119520 -10 Left 1197119517 X:122873772-122873794 CCTTCCCTCTGCTGCTACTACTG No data
Right 1197119520 X:122873785-122873807 GCTACTACTGACTGACCCTGAGG No data
1197119512_1197119520 29 Left 1197119512 X:122873733-122873755 CCCTATCTTTGCACATGTAGCAC No data
Right 1197119520 X:122873785-122873807 GCTACTACTGACTGACCCTGAGG No data
1197119516_1197119520 1 Left 1197119516 X:122873761-122873783 CCTCTTAAAGGCCTTCCCTCTGC No data
Right 1197119520 X:122873785-122873807 GCTACTACTGACTGACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197119520 Original CRISPR GCTACTACTGACTGACCCTG AGG Intergenic
No off target data available for this crispr