ID: 1197128617

View in Genome Browser
Species Human (GRCh38)
Location X:122977368-122977390
Sequence AACTAAATCATTGTCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197128617_1197128619 6 Left 1197128617 X:122977368-122977390 CCAGTCAGGACAATGATTTAGTT No data
Right 1197128619 X:122977397-122977419 CCATCAAGAATGTATTAGACTGG No data
1197128617_1197128620 16 Left 1197128617 X:122977368-122977390 CCAGTCAGGACAATGATTTAGTT No data
Right 1197128620 X:122977407-122977429 TGTATTAGACTGGCTTCCACTGG No data
1197128617_1197128621 28 Left 1197128617 X:122977368-122977390 CCAGTCAGGACAATGATTTAGTT No data
Right 1197128621 X:122977419-122977441 GCTTCCACTGGCAGCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197128617 Original CRISPR AACTAAATCATTGTCCTGAC TGG (reversed) Intergenic
No off target data available for this crispr