ID: 1197128864 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:122980402-122980424 |
| Sequence | GGCTGTGTATGGAGGAAAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197128864_1197128870 | 0 | Left | 1197128864 | X:122980402-122980424 | CCTCCTTTCCTCCATACACAGCC | No data | ||
| Right | 1197128870 | X:122980425-122980447 | AGATGATAATCATTGCAGTAGGG | No data | ||||
| 1197128864_1197128869 | -1 | Left | 1197128864 | X:122980402-122980424 | CCTCCTTTCCTCCATACACAGCC | No data | ||
| Right | 1197128869 | X:122980424-122980446 | CAGATGATAATCATTGCAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197128864 | Original CRISPR | GGCTGTGTATGGAGGAAAGG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||