ID: 1197128864

View in Genome Browser
Species Human (GRCh38)
Location X:122980402-122980424
Sequence GGCTGTGTATGGAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197128864_1197128870 0 Left 1197128864 X:122980402-122980424 CCTCCTTTCCTCCATACACAGCC No data
Right 1197128870 X:122980425-122980447 AGATGATAATCATTGCAGTAGGG No data
1197128864_1197128869 -1 Left 1197128864 X:122980402-122980424 CCTCCTTTCCTCCATACACAGCC No data
Right 1197128869 X:122980424-122980446 CAGATGATAATCATTGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197128864 Original CRISPR GGCTGTGTATGGAGGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr