ID: 1197129506

View in Genome Browser
Species Human (GRCh38)
Location X:122988815-122988837
Sequence CTGTAGCAATGGAGAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197129506_1197129511 7 Left 1197129506 X:122988815-122988837 CCATCTTTTCTCCATTGCTACAG No data
Right 1197129511 X:122988845-122988867 AAAGGCTCAATTATGCCTGTGGG No data
1197129506_1197129512 8 Left 1197129506 X:122988815-122988837 CCATCTTTTCTCCATTGCTACAG No data
Right 1197129512 X:122988846-122988868 AAGGCTCAATTATGCCTGTGGGG No data
1197129506_1197129510 6 Left 1197129506 X:122988815-122988837 CCATCTTTTCTCCATTGCTACAG No data
Right 1197129510 X:122988844-122988866 CAAAGGCTCAATTATGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197129506 Original CRISPR CTGTAGCAATGGAGAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr