ID: 1197130040

View in Genome Browser
Species Human (GRCh38)
Location X:122994828-122994850
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197130040_1197130049 22 Left 1197130040 X:122994828-122994850 CCCTGACCCATCTGATTTACCAG No data
Right 1197130049 X:122994873-122994895 CCTAGTCTTCTTAGTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197130040 Original CRISPR CTGGTAAATCAGATGGGTCA GGG (reversed) Intergenic
No off target data available for this crispr