ID: 1197132306

View in Genome Browser
Species Human (GRCh38)
Location X:123019678-123019700
Sequence AGGCAGGAATGGCCTGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132306_1197132315 -1 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132315 X:123019700-123019722 TGGCACCACAGGGATCCATCAGG No data
1197132306_1197132321 19 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132321 X:123019720-123019742 AGGAGGGCAGCCAGAGGAGCAGG No data
1197132306_1197132316 2 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data
1197132306_1197132322 20 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132322 X:123019721-123019743 GGAGGGCAGCCAGAGGAGCAGGG No data
1197132306_1197132324 22 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132306_1197132319 13 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132306_1197132317 3 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data
1197132306_1197132323 21 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132323 X:123019722-123019744 GAGGGCAGCCAGAGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132306 Original CRISPR AGGCAGGAATGGCCTGCCAG GGG (reversed) Intergenic