ID: 1197132310

View in Genome Browser
Species Human (GRCh38)
Location X:123019689-123019711
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132310_1197132321 8 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132321 X:123019720-123019742 AGGAGGGCAGCCAGAGGAGCAGG No data
1197132310_1197132326 25 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132326 X:123019737-123019759 AGCAGGGGGTAAAACTCCACAGG No data
1197132310_1197132317 -8 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data
1197132310_1197132327 26 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132310_1197132324 11 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132310_1197132323 10 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132323 X:123019722-123019744 GAGGGCAGCCAGAGGAGCAGGGG No data
1197132310_1197132319 2 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132310_1197132316 -9 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data
1197132310_1197132322 9 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132322 X:123019721-123019743 GGAGGGCAGCCAGAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132310 Original CRISPR CCTGTGGTGCCAGGCAGGAA TGG (reversed) Intergenic