ID: 1197132313

View in Genome Browser
Species Human (GRCh38)
Location X:123019694-123019716
Sequence GGATCCCTGTGGTGCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132313_1197132324 6 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132313_1197132327 21 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132313_1197132319 -3 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132313_1197132328 27 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132328 X:123019744-123019766 GGTAAAACTCCACAGGGAAAAGG No data
1197132313_1197132323 5 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132323 X:123019722-123019744 GAGGGCAGCCAGAGGAGCAGGGG No data
1197132313_1197132321 3 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132321 X:123019720-123019742 AGGAGGGCAGCCAGAGGAGCAGG No data
1197132313_1197132322 4 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132322 X:123019721-123019743 GGAGGGCAGCCAGAGGAGCAGGG No data
1197132313_1197132326 20 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132326 X:123019737-123019759 AGCAGGGGGTAAAACTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132313 Original CRISPR GGATCCCTGTGGTGCCAGGC AGG (reversed) Intergenic