ID: 1197132314

View in Genome Browser
Species Human (GRCh38)
Location X:123019698-123019720
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 35, 1: 98, 2: 99, 3: 128, 4: 333}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132314_1197132327 17 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132314_1197132321 -1 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132321 X:123019720-123019742 AGGAGGGCAGCCAGAGGAGCAGG No data
1197132314_1197132319 -7 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132314_1197132324 2 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132314_1197132328 23 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132328 X:123019744-123019766 GGTAAAACTCCACAGGGAAAAGG 0: 3
1: 69
2: 87
3: 83
4: 373
1197132314_1197132326 16 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132326 X:123019737-123019759 AGCAGGGGGTAAAACTCCACAGG No data
1197132314_1197132323 1 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132323 X:123019722-123019744 GAGGGCAGCCAGAGGAGCAGGGG No data
1197132314_1197132322 0 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132322 X:123019721-123019743 GGAGGGCAGCCAGAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132314 Original CRISPR TGATGGATCCCTGTGGTGCC AGG (reversed) Intergenic