ID: 1197132315

View in Genome Browser
Species Human (GRCh38)
Location X:123019700-123019722
Sequence TGGCACCACAGGGATCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132303_1197132315 17 Left 1197132303 X:123019660-123019682 CCTGGGAGCTTGCTGGGTCCCCT No data
Right 1197132315 X:123019700-123019722 TGGCACCACAGGGATCCATCAGG No data
1197132307_1197132315 -2 Left 1197132307 X:123019679-123019701 CCCTGGCAGGCCATTCCTGCCTG No data
Right 1197132315 X:123019700-123019722 TGGCACCACAGGGATCCATCAGG No data
1197132308_1197132315 -3 Left 1197132308 X:123019680-123019702 CCTGGCAGGCCATTCCTGCCTGG No data
Right 1197132315 X:123019700-123019722 TGGCACCACAGGGATCCATCAGG No data
1197132302_1197132315 18 Left 1197132302 X:123019659-123019681 CCCTGGGAGCTTGCTGGGTCCCC No data
Right 1197132315 X:123019700-123019722 TGGCACCACAGGGATCCATCAGG No data
1197132306_1197132315 -1 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132315 X:123019700-123019722 TGGCACCACAGGGATCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132315 Original CRISPR TGGCACCACAGGGATCCATC AGG Intergenic