ID: 1197132316

View in Genome Browser
Species Human (GRCh38)
Location X:123019703-123019725
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132307_1197132316 1 Left 1197132307 X:123019679-123019701 CCCTGGCAGGCCATTCCTGCCTG No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data
1197132308_1197132316 0 Left 1197132308 X:123019680-123019702 CCTGGCAGGCCATTCCTGCCTGG No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data
1197132302_1197132316 21 Left 1197132302 X:123019659-123019681 CCCTGGGAGCTTGCTGGGTCCCC No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data
1197132306_1197132316 2 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data
1197132303_1197132316 20 Left 1197132303 X:123019660-123019682 CCTGGGAGCTTGCTGGGTCCCCT No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data
1197132310_1197132316 -9 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132316 X:123019703-123019725 CACCACAGGGATCCATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132316 Original CRISPR CACCACAGGGATCCATCAGG AGG Intergenic