ID: 1197132317

View in Genome Browser
Species Human (GRCh38)
Location X:123019704-123019726
Sequence ACCACAGGGATCCATCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132310_1197132317 -8 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data
1197132307_1197132317 2 Left 1197132307 X:123019679-123019701 CCCTGGCAGGCCATTCCTGCCTG No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data
1197132303_1197132317 21 Left 1197132303 X:123019660-123019682 CCTGGGAGCTTGCTGGGTCCCCT No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data
1197132306_1197132317 3 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data
1197132308_1197132317 1 Left 1197132308 X:123019680-123019702 CCTGGCAGGCCATTCCTGCCTGG No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data
1197132302_1197132317 22 Left 1197132302 X:123019659-123019681 CCCTGGGAGCTTGCTGGGTCCCC No data
Right 1197132317 X:123019704-123019726 ACCACAGGGATCCATCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132317 Original CRISPR ACCACAGGGATCCATCAGGA GGG Intergenic