ID: 1197132318

View in Genome Browser
Species Human (GRCh38)
Location X:123019705-123019727
Sequence GCCCTCCTGATGGATCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132318_1197132326 9 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132326 X:123019737-123019759 AGCAGGGGGTAAAACTCCACAGG No data
1197132318_1197132323 -6 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132323 X:123019722-123019744 GAGGGCAGCCAGAGGAGCAGGGG No data
1197132318_1197132327 10 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132318_1197132322 -7 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132322 X:123019721-123019743 GGAGGGCAGCCAGAGGAGCAGGG No data
1197132318_1197132321 -8 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132321 X:123019720-123019742 AGGAGGGCAGCCAGAGGAGCAGG No data
1197132318_1197132328 16 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132328 X:123019744-123019766 GGTAAAACTCCACAGGGAAAAGG 0: 3
1: 69
2: 87
3: 83
4: 373
1197132318_1197132324 -5 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132318 Original CRISPR GCCCTCCTGATGGATCCCTG TGG (reversed) Intergenic