ID: 1197132319

View in Genome Browser
Species Human (GRCh38)
Location X:123019714-123019736
Sequence TCCATCAGGAGGGCAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132307_1197132319 12 Left 1197132307 X:123019679-123019701 CCCTGGCAGGCCATTCCTGCCTG No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132313_1197132319 -3 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132308_1197132319 11 Left 1197132308 X:123019680-123019702 CCTGGCAGGCCATTCCTGCCTGG No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132306_1197132319 13 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132310_1197132319 2 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data
1197132314_1197132319 -7 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132319 X:123019714-123019736 TCCATCAGGAGGGCAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132319 Original CRISPR TCCATCAGGAGGGCAGCCAG AGG Intergenic