ID: 1197132320

View in Genome Browser
Species Human (GRCh38)
Location X:123019715-123019737
Sequence TCCTCTGGCTGCCCTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132320_1197132327 0 Left 1197132320 X:123019715-123019737 CCATCAGGAGGGCAGCCAGAGGA No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132320_1197132328 6 Left 1197132320 X:123019715-123019737 CCATCAGGAGGGCAGCCAGAGGA No data
Right 1197132328 X:123019744-123019766 GGTAAAACTCCACAGGGAAAAGG No data
1197132320_1197132326 -1 Left 1197132320 X:123019715-123019737 CCATCAGGAGGGCAGCCAGAGGA No data
Right 1197132326 X:123019737-123019759 AGCAGGGGGTAAAACTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132320 Original CRISPR TCCTCTGGCTGCCCTCCTGA TGG (reversed) Intergenic