ID: 1197132324

View in Genome Browser
Species Human (GRCh38)
Location X:123019723-123019745
Sequence AGGGCAGCCAGAGGAGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132307_1197132324 21 Left 1197132307 X:123019679-123019701 CCCTGGCAGGCCATTCCTGCCTG No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132308_1197132324 20 Left 1197132308 X:123019680-123019702 CCTGGCAGGCCATTCCTGCCTGG No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132318_1197132324 -5 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132306_1197132324 22 Left 1197132306 X:123019678-123019700 CCCCTGGCAGGCCATTCCTGCCT No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132314_1197132324 2 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA 0: 35
1: 98
2: 99
3: 128
4: 333
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132310_1197132324 11 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data
1197132313_1197132324 6 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132324 X:123019723-123019745 AGGGCAGCCAGAGGAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132324 Original CRISPR AGGGCAGCCAGAGGAGCAGG GGG Intergenic