ID: 1197132327

View in Genome Browser
Species Human (GRCh38)
Location X:123019738-123019760
Sequence GCAGGGGGTAAAACTCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197132320_1197132327 0 Left 1197132320 X:123019715-123019737 CCATCAGGAGGGCAGCCAGAGGA No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132313_1197132327 21 Left 1197132313 X:123019694-123019716 CCTGCCTGGCACCACAGGGATCC No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132310_1197132327 26 Left 1197132310 X:123019689-123019711 CCATTCCTGCCTGGCACCACAGG No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132314_1197132327 17 Left 1197132314 X:123019698-123019720 CCTGGCACCACAGGGATCCATCA No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data
1197132318_1197132327 10 Left 1197132318 X:123019705-123019727 CCACAGGGATCCATCAGGAGGGC No data
Right 1197132327 X:123019738-123019760 GCAGGGGGTAAAACTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197132327 Original CRISPR GCAGGGGGTAAAACTCCACA GGG Intergenic