ID: 1197136260

View in Genome Browser
Species Human (GRCh38)
Location X:123063462-123063484
Sequence CTGTGTAAATAAATATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197136260_1197136266 17 Left 1197136260 X:123063462-123063484 CCCATATATATTTATTTACACAG No data
Right 1197136266 X:123063502-123063524 AACACAGGTTTGAACTGTACAGG No data
1197136260_1197136262 2 Left 1197136260 X:123063462-123063484 CCCATATATATTTATTTACACAG No data
Right 1197136262 X:123063487-123063509 AGCTGCCCCTTGAACAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197136260 Original CRISPR CTGTGTAAATAAATATATAT GGG (reversed) Intergenic
No off target data available for this crispr