ID: 1197137120

View in Genome Browser
Species Human (GRCh38)
Location X:123074436-123074458
Sequence CTCAGGGACAGCTTCATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197137115_1197137120 0 Left 1197137115 X:123074413-123074435 CCTCAAGAGTAGCTTTTGCTAAC No data
Right 1197137120 X:123074436-123074458 CTCAGGGACAGCTTCATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197137120 Original CRISPR CTCAGGGACAGCTTCATGCA GGG Intergenic
No off target data available for this crispr