ID: 1197141566

View in Genome Browser
Species Human (GRCh38)
Location X:123122523-123122545
Sequence TGTCAGCCAAAGCACTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197141566_1197141569 11 Left 1197141566 X:123122523-123122545 CCTACAAAGTGCTTTGGCTGACA No data
Right 1197141569 X:123122557-123122579 AGTGTTGTGACCAGCAGTCTTGG 0: 7
1: 25
2: 39
3: 90
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197141566 Original CRISPR TGTCAGCCAAAGCACTTTGT AGG (reversed) Intergenic
No off target data available for this crispr