ID: 1197147863

View in Genome Browser
Species Human (GRCh38)
Location X:123188797-123188819
Sequence TTTCTAGGGTGTAGGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197147857_1197147863 3 Left 1197147857 X:123188771-123188793 CCCTCAATCCTGAGGCAGGCACA 0: 1
1: 0
2: 0
3: 21
4: 176
Right 1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 343
1197147859_1197147863 -5 Left 1197147859 X:123188779-123188801 CCTGAGGCAGGCACACACTTTCT 0: 1
1: 0
2: 2
3: 20
4: 234
Right 1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 343
1197147858_1197147863 2 Left 1197147858 X:123188772-123188794 CCTCAATCCTGAGGCAGGCACAC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 343
1197147855_1197147863 9 Left 1197147855 X:123188765-123188787 CCTGCACCCTCAATCCTGAGGCA 0: 1
1: 0
2: 0
3: 18
4: 216
Right 1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197147863 Original CRISPR TTTCTAGGGTGTAGGTGTGC AGG Intronic
906534628 1:46544629-46544651 TTTCTAGGGTGCAGGATTGGTGG - Intergenic
907435772 1:54445990-54446012 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
907549700 1:55294150-55294172 TTGCGAGGGTGTATGTGTCCAGG - Intergenic
909485744 1:76171705-76171727 TTGGTAGGGTGTATGTGTCCAGG - Intronic
910319127 1:85924086-85924108 TTTGGAGGGTGTATGTGTCCAGG - Intronic
910678908 1:89843225-89843247 TTTCTGGGGGGTAGGGGTGGGGG + Intronic
910714206 1:90212986-90213008 TTCTTATGGTGTTGGTGTGCTGG + Intergenic
911351137 1:96756763-96756785 TTGCTAGGGTTTAGGGGTGGAGG + Intronic
912133053 1:106625496-106625518 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
912236720 1:107859358-107859380 TCTCAAGGGGCTAGGTGTGCTGG - Intronic
912300949 1:108516507-108516529 TTCGTAGGGTGTATGTGTCCAGG + Intergenic
916763314 1:167836271-167836293 TCTCTAGGGTGGAGGTGGTCTGG + Intronic
917043926 1:170835613-170835635 TTGCAAGGGTGTATGTGTCCAGG - Intergenic
917266929 1:173230861-173230883 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
917305597 1:173621071-173621093 TTTGGAGGGTGTATGTGTCCAGG - Intronic
917738029 1:177938013-177938035 TTCTTAAGGTGTAGGGGTGCGGG - Intronic
918169115 1:181978701-181978723 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
918501143 1:185197681-185197703 TTGGTAGGGTGTATGTGTCCAGG + Intronic
918697023 1:187557473-187557495 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
918890081 1:190255507-190255529 TTGGGAGGGTGTAGGTGTCCAGG + Intronic
919031247 1:192245618-192245640 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
1065391426 10:25186639-25186661 TTGGGAGGGTGTATGTGTGCAGG - Intronic
1065735673 10:28749647-28749669 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1065815307 10:29477758-29477780 TTTCTAAGTTGTAAGTCTGCTGG + Intronic
1067161882 10:43833304-43833326 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
1067779212 10:49186908-49186930 TTTTTAGTGTGTCGATGTGCTGG - Intronic
1068126522 10:52847987-52848009 TTTGAAGGGTGTATGTGTCCAGG + Intergenic
1068477675 10:57548999-57549021 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1068575462 10:58679452-58679474 TTTGGAGGGTGTATGTGTCCAGG - Intronic
1069244930 10:66192232-66192254 TGTGTAGGGTGTAGTTCTGCTGG - Intronic
1070632841 10:78100071-78100093 TTGGGAGGGTGTAGGTGTCCAGG - Intergenic
1071099938 10:82024075-82024097 TTGGTAGGTTGTATGTGTGCAGG + Intronic
1071210852 10:83340097-83340119 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1072389774 10:94971261-94971283 GTTCTAGGGTGCAGTAGTGCAGG - Intronic
1072394047 10:95020182-95020204 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
1072876494 10:99178536-99178558 TTTGGAGGGTGTATGTGTCCAGG - Intronic
1073884657 10:108024432-108024454 TTGGGAGGGTGTAGGTGTCCAGG - Intergenic
1075541732 10:123319291-123319313 TTTCTAGGCTTTAGGCCTGCAGG - Intergenic
1076901310 10:133339663-133339685 TGTCTAGGGTGTATGTGTGAAGG - Intronic
1077124540 11:926394-926416 TGTCCAGGGTCTAGGGGTGCGGG + Intronic
1077765864 11:5159771-5159793 TTGCTAGGCTGTATGTGTCCAGG + Intronic
1080200672 11:29666066-29666088 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1081086357 11:38806382-38806404 TTTCAAGGGTGTGTGTGTGGGGG + Intergenic
1081171648 11:39877002-39877024 TTTTGAGGGTGTATGTGTCCAGG - Intergenic
1081670647 11:44940414-44940436 TTGCCAGGGTGGAGGTGTGAGGG - Intronic
1081957976 11:47110180-47110202 ATTCTAGTGTGTATGTGTGGAGG - Intronic
1082561068 11:54621466-54621488 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1082674375 11:56077694-56077716 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1082886671 11:58090867-58090889 TTTGGAGGGTGTATGTGTCCAGG + Intronic
1085840517 11:80006491-80006513 TTTCTGTGGTATAGGTCTGCTGG - Intergenic
1086848476 11:91781091-91781113 TTTCTGGGCTGTAGGTATGTGGG + Intergenic
1086868783 11:92012240-92012262 TTGAGAGGGTGTAGGTGTCCAGG + Intergenic
1087370977 11:97283555-97283577 TTAGTAGGTTGTAAGTGTGCAGG - Intergenic
1088167273 11:106953747-106953769 TTGGTAGGGTGTATGTGTCCAGG + Intronic
1091293854 11:134458985-134459007 TTTATAGGGTGTAGGACTGTAGG + Intergenic
1092012965 12:5131021-5131043 TTTCAAGTGTGTATGTGAGCAGG + Intergenic
1093808775 12:23467670-23467692 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
1094127948 12:27043436-27043458 TTGGGAGGGTGTATGTGTGCAGG - Intronic
1094134628 12:27111156-27111178 TTTCTAGGGGGAAAGTGTGCTGG + Intergenic
1094184746 12:27628947-27628969 TTTCTAGGGGGAAAGTGTGCTGG + Intronic
1094528383 12:31249128-31249150 TTGCTGGGGTGTAGTTGTGAGGG - Intergenic
1095186913 12:39211148-39211170 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1095557030 12:43519670-43519692 TTACCATGGGGTAGGTGTGCCGG - Intronic
1096600300 12:52724250-52724272 TTTCTAGTTTGCAGGTGTGGGGG - Intergenic
1097336386 12:58388342-58388364 TTTCTAGAGTGTGAGTCTGCTGG + Intergenic
1097886155 12:64731483-64731505 TTTCTAGGGAGAAGGAGTCCTGG - Intronic
1097917173 12:65033171-65033193 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1098556119 12:71820906-71820928 TTTCTAGGGGCTAGGGGTGGGGG - Intergenic
1099550742 12:84040495-84040517 TTTGTAGGGTGTATGTGTCCAGG + Intergenic
1099892545 12:88607754-88607776 TTGCGAGGGTGTATGTGTCCAGG - Intergenic
1100025118 12:90118883-90118905 TTTGTAGGTTGTATGTGTTCAGG + Intergenic
1100389196 12:94132661-94132683 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
1101202679 12:102453255-102453277 TTTATAGGATGTAGGTTTTCAGG + Intronic
1101290343 12:103361632-103361654 TTTCTAGGCAGTGGGTGAGCAGG - Intronic
1102871491 12:116417576-116417598 TTTGAAGGGAGTAGGTGTTCTGG + Intergenic
1104191947 12:126490480-126490502 GTTCTAGGGGGCAGGTGTGTTGG + Intergenic
1104204357 12:126622976-126622998 TTCCCATGGGGTAGGTGTGCAGG - Intergenic
1106611997 13:31292535-31292557 TTGGGAGGGTGTAGGTGTCCAGG + Intronic
1108160714 13:47635715-47635737 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
1108600178 13:51986331-51986353 TTTGGAGGGTGTATGTGTCCAGG - Intronic
1109629585 13:65028688-65028710 TTTGTAGGTTGTAAGTGTCCAGG + Intergenic
1111029604 13:82577855-82577877 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
1112898602 13:104332605-104332627 TTTAGAGGGTGTACGTGTCCAGG + Intergenic
1113615494 13:111677641-111677663 TTTCTGTTGTGTATGTGTGCCGG - Intergenic
1113620962 13:111762543-111762565 TTTCTGTTGTGTATGTGTGCCGG - Intergenic
1113966154 13:114155119-114155141 GTTAGAGGGTGTAGGTGTGGGGG + Intergenic
1115282808 14:31683768-31683790 TTTCTATGTTGTGGGTCTGCTGG + Intronic
1116434576 14:44882106-44882128 TTTGTAGGTTGTATGTGTCCAGG - Intergenic
1116488895 14:45483358-45483380 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1116511517 14:45752750-45752772 TTGAGAGGGTGTAGGTGTCCAGG + Intergenic
1116672408 14:47860490-47860512 TGCCTAGGGTGTAGGTCTACAGG + Intergenic
1117822641 14:59666857-59666879 TTGGGAGGGTGTATGTGTGCAGG - Intronic
1118498754 14:66336190-66336212 TTGCAAGGGTGTATGTGTCCAGG - Intergenic
1120368705 14:83604949-83604971 TTTAGAGGGTGTATGTGTGCAGG + Intergenic
1126715249 15:51509473-51509495 TTTGGAGGGTGTATGTGTCCAGG - Intronic
1127042663 15:54994198-54994220 TTGGGAGGGTGTATGTGTGCAGG - Intergenic
1127186819 15:56489041-56489063 TTTATAGGATGTAGGGGTGAAGG + Intergenic
1129342876 15:74897594-74897616 TGTCTGGGTTGTGGGTGTGCTGG - Exonic
1129642736 15:77397697-77397719 TTTGTAGGTTGTATGTGTGTTGG - Intronic
1130571988 15:85054540-85054562 TTTGGAGGGTGTATGTGTCCAGG + Intronic
1135301481 16:21331748-21331770 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
1136983891 16:35082557-35082579 TTTGGAGGGTGCAGGTGTGATGG - Intergenic
1137438616 16:48479352-48479374 TTCCTAGGGTGTAGGTCTTCTGG + Intergenic
1140142277 16:72269849-72269871 TTTCGTGGGAGTAGGTGGGCGGG + Intergenic
1140185469 16:72766131-72766153 TTTATAGAGTTTAGTTGTGCTGG + Intergenic
1140712940 16:77695122-77695144 TTTTTAGGGGGTGGGTGGGCGGG + Intergenic
1140907220 16:79419136-79419158 CTGCCAGGGTGAAGGTGTGCTGG + Intergenic
1141970152 16:87476190-87476212 TTTCGGGAGTGTAGGTGTGCTGG - Intronic
1142592382 17:1012052-1012074 TCTCCAGGGTGTGTGTGTGCTGG - Intronic
1149174747 17:53856176-53856198 TTGGTAGGGTGTATGTGTACAGG - Intergenic
1149567314 17:57649479-57649501 TTTGTTGGGTGTATGTGTGTTGG - Intronic
1151420329 17:73992928-73992950 TGTGTAGGGTATAGGTGAGCAGG + Intergenic
1153418999 18:4883242-4883264 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1155893122 18:31290657-31290679 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1156002279 18:32398583-32398605 TTGGGAGGGTGTATGTGTGCAGG - Intronic
1156529631 18:37802626-37802648 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1157067001 18:44363722-44363744 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1158105344 18:53879587-53879609 TTGCAAGGGTGTATGTGTCCAGG + Intergenic
1159308588 18:66678273-66678295 TTTCTAGGGTGATGGTGAGAAGG + Intergenic
1159902075 18:74056642-74056664 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
1161143755 19:2664798-2664820 TCTCTAGGGTGCAGCTGTCCCGG + Intronic
1161165997 19:2787837-2787859 TTTCTGGGGTGGAGCTGTCCTGG - Intronic
1162878375 19:13638058-13638080 TTTTTAGGGTGTGGGAGTGAGGG + Intergenic
926231245 2:11005741-11005763 CTTCTAGGCTGCAGGTGTGAAGG + Intergenic
929144732 2:38696757-38696779 TTTCTTGGGGGTAGGTGCGGTGG - Intronic
931736776 2:65201922-65201944 TTGCTAGGTTGTATGTGTCCAGG - Intergenic
932328285 2:70879314-70879336 TTGGGAGGGTGTATGTGTGCAGG - Intergenic
935851532 2:107226017-107226039 TTTCTATTGTGTAGGTGAGTTGG + Intergenic
938951959 2:136263154-136263176 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
939975887 2:148716964-148716986 TTTGGAGGGTGTATGTGTCCAGG + Intronic
940090502 2:149911063-149911085 TTTGCAGGGTGTATGTGTCCAGG - Intergenic
940303015 2:152195685-152195707 TTTGGAGGGTGTAGGTGTCCAGG - Intergenic
941477052 2:165962390-165962412 TTACTAGGTTGTATGTGTCCAGG + Intergenic
941681982 2:168409744-168409766 TTGCAAGGGTGTATGTGTCCAGG + Intergenic
942197302 2:173533971-173533993 TTGGTAGGTTGTAGGTGTCCAGG + Intergenic
943955949 2:194189486-194189508 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
944259717 2:197663551-197663573 TTGGTAGGTTGTATGTGTGCAGG + Intronic
945315512 2:208367001-208367023 CTTCCATGGCGTAGGTGTGCTGG + Intronic
945388298 2:209230658-209230680 TTAGTAGGGTGTATGTGTCCTGG + Intergenic
945501167 2:210577414-210577436 TTTCTAGGTTTCAGGTTTGCTGG + Exonic
946985011 2:225262100-225262122 TTGGTAGGTTGTATGTGTGCAGG - Intergenic
947449269 2:230191549-230191571 TTGATAGGGTGTATGTGTCCAGG - Intronic
947451119 2:230209932-230209954 TTTCTTGTCTGAAGGTGTGCTGG + Exonic
1169107197 20:3006464-3006486 TTTTTAGGGTCTAGATGTGGTGG - Intronic
1169978884 20:11361271-11361293 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
1170454162 20:16517041-16517063 TGTCTAGGGTGTGGGTGTTGTGG - Intronic
1170586369 20:17737323-17737345 TTTCTAGGGAGTAGGAGTAGGGG - Intergenic
1171200651 20:23238886-23238908 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1171262924 20:23748915-23748937 TTTGGAGGGTGTGTGTGTGCAGG - Intronic
1171272045 20:23825109-23825131 TTTGGAGGGTGTGTGTGTGCAGG - Intronic
1173469064 20:43308540-43308562 TCTCTAGGGAGTAGGTGTTGAGG + Intergenic
1174695877 20:52557716-52557738 TTGCTAGGTTGTATGTGTCCAGG + Intergenic
1174741780 20:53021239-53021261 TTTCTGGGGGGAAGGTGTGCAGG + Intronic
1175177466 20:57120836-57120858 TTTCCAGGATGAACGTGTGCAGG - Intergenic
1176942043 21:14936570-14936592 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1177755753 21:25345433-25345455 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1183574690 22:38680335-38680357 TTTCTAGTAAGTAGGTGAGCTGG - Intergenic
1184565639 22:45290079-45290101 GTGCTAAGGAGTAGGTGTGCAGG - Intronic
949155309 3:819900-819922 TTGGGAGGGTGTAGGTGTCCAGG - Intergenic
949175745 3:1060542-1060564 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
951254171 3:20429843-20429865 TTTGCAGGGTGTATGTGTCCAGG + Intergenic
951977536 3:28529550-28529572 TTGGGAGGGTGTAGGTGTCCAGG + Intronic
952676600 3:36038251-36038273 TTGGTAGGCTGTAGGTGTTCAGG + Intergenic
953215908 3:40917801-40917823 TTTCTAGAGAGTAGGTCAGCAGG - Intergenic
954481079 3:50802511-50802533 TTTTTAATGTGTAGGTTTGCTGG + Intronic
954724147 3:52592882-52592904 TTGCGAGGGTGTATGTGTTCAGG + Intronic
956386189 3:68722121-68722143 TTGAGAGGGTGTAGGTGTCCAGG + Intergenic
956993578 3:74797607-74797629 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
957872213 3:86103700-86103722 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
958030063 3:88098247-88098269 TTTGGAGGGTGTATGTGTGCAGG - Intronic
958037276 3:88185359-88185381 TTTGCAGGGTGTATGTGTCCAGG - Intergenic
958503431 3:94943629-94943651 TTGCGAGGGTGTATGTGTCCAGG + Intergenic
958986025 3:100780614-100780636 ATTCTAAGGTGTATGTGTGTGGG - Intronic
959256514 3:104021968-104021990 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
959725922 3:109541593-109541615 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
962410966 3:135141560-135141582 TTGCTAGGAGGTGGGTGTGCAGG + Intronic
962634525 3:137316962-137316984 TTGGTAGGGTGTGGGTGTCCAGG + Intergenic
963676924 3:148323705-148323727 TTGCGAGGGTGTATGTGTCCAGG + Intergenic
964659979 3:159109645-159109667 TTTCTTTGGTGTGGGTGTGTGGG + Intronic
964949694 3:162274846-162274868 TTACATGGCTGTAGGTGTGCAGG + Intergenic
964962930 3:162450384-162450406 TTCAGAGGGTGTAGGTGTCCAGG + Intergenic
965511250 3:169570255-169570277 TTTGGAGGGTGTACGTGTCCAGG - Intronic
966346444 3:178985987-178986009 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
968194444 3:196695026-196695048 TGTGTAGTGTGTGGGTGTGCGGG - Intronic
970107274 4:12598875-12598897 TTGGAAGGGTGTATGTGTGCAGG - Intergenic
970810042 4:20081751-20081773 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
971389790 4:26175338-26175360 CTTGTAGGGTGGAGGTGGGCAGG - Intronic
971708264 4:30076754-30076776 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
972624810 4:40786327-40786349 TTTCTGGGATGTAGGTGGTCAGG + Intronic
972914550 4:43859544-43859566 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
973111983 4:46408065-46408087 TTTGGAGGGTGTATGTGTCCAGG - Intronic
973237345 4:47919757-47919779 TTTTGAGGGTGTATGTGTCCAGG + Intronic
974130222 4:57745467-57745489 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
975303925 4:72825622-72825644 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
975306388 4:72854190-72854212 TTTGAAGGGTGTATGTGTCCAGG - Intergenic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
978236600 4:106468278-106468300 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
979667965 4:123333380-123333402 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
979729856 4:124011114-124011136 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
979968786 4:127109127-127109149 TTGCGAGGGTGTATGTGTCCAGG - Intergenic
980224511 4:129964182-129964204 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
980231749 4:130054199-130054221 TTTCAAGGCTGTATTTGTGCAGG + Intergenic
980260281 4:130439574-130439596 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
980793565 4:137651410-137651432 TTTGTGGGGTGTAGGGGTGGTGG - Intergenic
981345879 4:143675807-143675829 TTTGGAGGGTGTACGTGTGGAGG - Intronic
981668463 4:147257891-147257913 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
981795958 4:148595691-148595713 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
982121758 4:152150059-152150081 ATTCTAGAGTGTGGGTGTCCAGG + Intergenic
982642486 4:157980494-157980516 TTTCCATGGTGTAAGTGAGCAGG - Intergenic
982646440 4:158029750-158029772 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
982852644 4:160339208-160339230 TTTGAAGGGTGTATGTGTCCAGG + Intergenic
984283531 4:177701226-177701248 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
984618964 4:181930433-181930455 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
985290891 4:188386068-188386090 TTGGTAGGTTGTATGTGTGCAGG + Intergenic
985853291 5:2404737-2404759 TTTCTAGGGTTGAGCTGTGGAGG - Intergenic
985864708 5:2505387-2505409 TTTCATGGATGCAGGTGTGCGGG + Intergenic
986530737 5:8734262-8734284 TTGGGAGGGTGTATGTGTGCAGG - Intergenic
986586986 5:9328843-9328865 TTTCAAGAGTGTAGATGTCCAGG - Intronic
988116330 5:26897085-26897107 TTTGGAGGGTGTATGTGTCCAGG - Intronic
988139829 5:27222112-27222134 TTATTATGGTGTAGGTCTGCTGG + Intergenic
988623042 5:32842989-32843011 CTTCTAGGGTGTGTGTGTGTTGG + Intergenic
989081466 5:37626843-37626865 TTTATAGGTTGTATGTGTCCAGG + Intronic
990390705 5:55317047-55317069 TTTCTAGGGTGTGTGTGTGTGGG - Intronic
990733797 5:58837870-58837892 TTTGTTGGTTGTATGTGTGCAGG + Intronic
991182272 5:63766447-63766469 TTCCTTGGGTCTAGGTGTGGTGG - Intergenic
991199302 5:63972944-63972966 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
991282928 5:64936824-64936846 TTTGGAGGGTGTATGTGTCCAGG + Intronic
993494283 5:88590021-88590043 TTAGGAGGGTGTATGTGTGCAGG - Intergenic
994199856 5:96960503-96960525 ATTCTAGGGTGTGGGTTGGCGGG + Intronic
994547352 5:101183413-101183435 TTTCGAGAGTGTATGTGTCCAGG - Intergenic
994978491 5:106842148-106842170 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
995052534 5:107722656-107722678 TTGGGAGGGTGTATGTGTGCAGG - Intergenic
995110721 5:108425573-108425595 TTGATAGGGTGTATGTGTCCAGG + Intergenic
996256364 5:121409145-121409167 GTTCAGTGGTGTAGGTGTGCAGG + Intergenic
996639372 5:125733700-125733722 TTACAAGGGTGTATGTGTCCAGG - Intergenic
996675992 5:126175266-126175288 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
996678405 5:126202695-126202717 TTTCTAGGCAGTAGGTGAGCAGG - Intergenic
996878635 5:128268290-128268312 TTGGTAGGGTGTATGTGTCCAGG - Intronic
996883164 5:128324014-128324036 TTGGTAGGGTGTATGTGTCCAGG + Intronic
996894142 5:128459217-128459239 TTGGTAGGGTGTATGTGTCCAGG - Intronic
997437294 5:133884651-133884673 TTTCTAGGGTCATGGTGTGGGGG - Intergenic
997578354 5:135000645-135000667 TTGGGAGGGTGTAGGTGTCCAGG + Intronic
997876124 5:137549064-137549086 TTGGGAGGGTGTAGGTGTCCAGG - Intronic
998685088 5:144515268-144515290 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1003188571 6:3853407-3853429 TTTCCAGGATGTAGATGTGATGG - Intergenic
1008095045 6:47331250-47331272 TTGCGAGGGTGTACGTGTCCAGG - Intergenic
1008639805 6:53450171-53450193 TCTCTGGGGTGTGGGTGTGGTGG + Intergenic
1008938809 6:57022351-57022373 TTGCTAGGTTGTATGTGTCCAGG + Intronic
1009037290 6:58133258-58133280 TTGGGAGGGTGTAGGTGTCCAGG - Intergenic
1009213085 6:60886874-60886896 TTGGGAGGGTGTAGGTGTCCAGG - Intergenic
1009521471 6:64687949-64687971 TTTGCAGGGTGTATGTGTCCAGG + Intronic
1010520378 6:76824977-76824999 TTGGGAGGGTGTAGGTTTGCAGG + Intergenic
1011015920 6:82755316-82755338 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
1012808194 6:103922532-103922554 TTTCTATGGTGCAGGTGTGTAGG + Intergenic
1013258537 6:108414188-108414210 TTGGTAGGGTGTATGTGTCCAGG - Intronic
1013397016 6:109751639-109751661 TTGGGAGGGTGTATGTGTGCAGG + Intronic
1013734981 6:113215087-113215109 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
1014367241 6:120559887-120559909 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1014584895 6:123185866-123185888 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1015965199 6:138691047-138691069 TGTCTAGGGTGTAGGTACGTGGG - Intronic
1016432644 6:144003674-144003696 TTTCTTGGGTATATGTTTGCAGG - Intronic
1017400991 6:154061792-154061814 TTTTTAGGGAGTACATGTGCAGG - Intronic
1018114243 6:160567911-160567933 TTGGTAGGGTGTATGTGTCCAGG - Intronic
1018168068 6:161118537-161118559 TTTCTTGGGAGTAGATTTGCTGG + Intergenic
1020622099 7:10531050-10531072 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
1022013355 7:26328341-26328363 TGTCTAGGGTGTGGATGGGCAGG + Intronic
1027577039 7:79943814-79943836 TTAGGAGGGTGTATGTGTGCAGG + Intergenic
1028049181 7:86160794-86160816 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1028275988 7:88857529-88857551 TTGGGAGGGTGTAGGTGTCCAGG - Intronic
1028287410 7:89020304-89020326 TTTCTAAAGTGTAGCTTTGCTGG + Intronic
1028351099 7:89849693-89849715 TGTCTTGGGTGTAGGTGGGTGGG + Intergenic
1030709588 7:112734551-112734573 TTTCTAAAGTGTAGCTTTGCTGG + Intergenic
1032094636 7:128931967-128931989 TTGCTAGGGAGTAGGGGTGCAGG - Intergenic
1033809762 7:144998430-144998452 TTGCTAGGTTGTATGTGTCCAGG + Intergenic
1034358506 7:150473242-150473264 GTTGTAGGGTGCAGGTTTGCAGG + Intronic
1034366549 7:150554550-150554572 TTGGGAGGGTGTATGTGTGCAGG - Intergenic
1034705524 7:153139681-153139703 TTTCTAGGCAGTGGGTGAGCAGG + Intergenic
1035880962 8:3243476-3243498 TTTCTGGGGGGCAGGTGTGGAGG + Intronic
1036955525 8:13184040-13184062 TTTGGAGGGTGTATGTGTCCAGG + Intronic
1037033593 8:14139605-14139627 TTGCGAGGGTGTATGTGTCCAGG - Intronic
1037544820 8:19908934-19908956 TTTGGAGGGTGTATGTGTCCAGG + Intronic
1037545158 8:19912729-19912751 TTTGGAGGGTGTATGTGTCCAGG + Intronic
1037619693 8:20552450-20552472 TTGCTAAGGTCTATGTGTGCTGG + Intergenic
1037685478 8:21135690-21135712 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1038082998 8:24161264-24161286 TTTGGAGGGTGTAAGTGTCCAGG + Intergenic
1038093675 8:24283673-24283695 TTTGTAGGGTGTATGTGTCCAGG - Intergenic
1038946602 8:32368279-32368301 CTTCTAGGGTCTGGGTGTGGTGG + Intronic
1039347985 8:36729173-36729195 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1039677881 8:39690205-39690227 AGTCATGGGTGTAGGTGTGCTGG + Intronic
1040411081 8:47155138-47155160 TTGGGAGGGTGTATGTGTGCAGG - Intergenic
1040446668 8:47502365-47502387 TTGGGAGGGTGTATGTGTGCAGG + Intronic
1042006451 8:64185106-64185128 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1042613590 8:70624689-70624711 ATTGTAGGTTGTAGGTGTGGTGG - Intronic
1042851532 8:73221267-73221289 TTAGGAGGGTGTAGGTGTCCAGG + Intergenic
1042898742 8:73699585-73699607 TTTGTAGGGTGTATGTGTCTAGG - Intronic
1043298873 8:78702195-78702217 TTGGGAGGGTGTAGGTGTCCAGG + Intronic
1044440543 8:92218790-92218812 TTTGGAGGGTGTATGTGTTCAGG + Intergenic
1045390896 8:101713697-101713719 TTTGGAGGGTGTATGTGTCCAGG - Intronic
1045994152 8:108343111-108343133 TTTCCAGGGAGTGGGTGAGCAGG - Intronic
1046257434 8:111719847-111719869 TTTGTAGGTTGTATGTGTCCAGG + Intergenic
1046709157 8:117490077-117490099 TTGGTAGGGTGTATGTGTCCGGG - Intergenic
1046940676 8:119928044-119928066 TTTCTAGGGTTTTTGTTTGCTGG + Intronic
1049756181 8:144312194-144312216 TTTCAGGGGTGGAGGTGGGCGGG - Exonic
1050049664 9:1586144-1586166 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
1051018095 9:12506201-12506223 TTGCGAGGGTGTATGTGTCCAGG - Intergenic
1052094336 9:24366301-24366323 TTGATAGGGTGTATGTGTCCAGG + Intergenic
1055294746 9:74822540-74822562 TTTATAGAGTCTAGGTGTGGTGG - Intronic
1057018032 9:91671274-91671296 TTTGGAGGGTGTATGTGTTCTGG + Intronic
1058514419 9:105755055-105755077 TTGCAAGGGTGTATGTGTCCAGG - Intronic
1059010732 9:110456142-110456164 TTTCTATGGGCTAGCTGTGCTGG + Intronic
1060731074 9:126037373-126037395 TTTCAAGGGAGTCGGTCTGCAGG + Intergenic
1061775693 9:132962050-132962072 TGTGTAGAGTGTAGGTGTGTAGG - Intronic
1185643750 X:1602169-1602191 TTTCTAAGGTGTCGGTATGTGGG + Exonic
1186431252 X:9506703-9506725 TTGGTAGGGTGTATGCGTGCAGG - Intronic
1187567011 X:20460721-20460743 TTTCTGGGGTGTCGGTGGGGGGG + Intergenic
1187634733 X:21214794-21214816 TTGGGAGGGTGTATGTGTGCAGG - Intergenic
1187749807 X:22449781-22449803 TTTATAGGTTGTATGTGTCCAGG - Intergenic
1188708161 X:33360882-33360904 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1189618784 X:42813397-42813419 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
1189854873 X:45214253-45214275 TTCCTAGGGGGTATGTGTGGAGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190550868 X:51579068-51579090 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
1191022908 X:55881732-55881754 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1191034663 X:56011872-56011894 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1191137927 X:57086085-57086107 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1191203309 X:57807757-57807779 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
1191692287 X:63952786-63952808 TTTCTAGGCAGTGGGTGAGCAGG - Intergenic
1191766268 X:64701941-64701963 TTTAGAGGGTGTAGGTGTCCAGG + Intergenic
1191771301 X:64761765-64761787 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1191797256 X:65034675-65034697 TTTCTAGGTCGTAGGCCTGCTGG + Intronic
1191933589 X:66401712-66401734 TTGGGAGGGTGTATGTGTGCAGG + Intergenic
1192063560 X:67856620-67856642 TTGCAAGGGTGTATGTGTCCAGG - Intergenic
1192067911 X:67905334-67905356 TTTGTAGGTTGTAGGTGTCCAGG - Intergenic
1192135427 X:68594527-68594549 TTGGTAGGTTGTATGTGTGCAGG - Intergenic
1192936122 X:75859908-75859930 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1193005247 X:76610266-76610288 TTTGTAGGGTGTATGTGTCTGGG - Intergenic
1193063121 X:77228037-77228059 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
1193209440 X:78788693-78788715 TTTATAGGTTGTAGGTGTCTAGG + Intergenic
1193338889 X:80322845-80322867 TTGGTAGGGTGTATGTGTCCAGG - Intergenic
1193532577 X:82674363-82674385 TTCCCAGGGTGTAGGGGAGCTGG + Intergenic
1194201849 X:90961415-90961437 TTTGAAGGGTGTATGTGTCCAGG - Intergenic
1194252154 X:91589218-91589240 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1194922096 X:99779194-99779216 CTGCTAGGGGGTGGGTGTGCAGG + Intergenic
1195226001 X:102794137-102794159 TTGGTAGGGTGTATGTGTCCAGG + Intergenic
1195528866 X:105928215-105928237 TTGCTAGGTTGTATGTGTCCAGG + Intronic
1196527401 X:116741891-116741913 TTGGGAGGGTGTAGGTGTCCAGG + Intergenic
1196570021 X:117255017-117255039 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG + Intronic
1197586116 X:128350429-128350451 TTTGGAGGGTGTATGTGTCCAGG + Intergenic
1198115050 X:133536717-133536739 GTTCTTGTGTGTATGTGTGCTGG + Intronic
1198738311 X:139812218-139812240 TTTCTGGAGTGTAAGTGTGTGGG - Intronic
1200379808 X:155823641-155823663 TTGCTAGGTTGTATGTGTGTAGG - Intergenic
1200547687 Y:4536867-4536889 TTTGAAGGGTGTATGTGTCCAGG - Intergenic
1200571085 Y:4830457-4830479 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1200771779 Y:7132529-7132551 TTGCAAGGGTGTATGTGTCCCGG + Intergenic
1200863898 Y:8022137-8022159 TTTCAATGCTGTATGTGTGCAGG + Intergenic
1201639232 Y:16160930-16160952 TTTGGAGGGTGTAGGTGTCCAGG + Intergenic
1201663581 Y:16424397-16424419 TTTGGAGGGTGTAGGTGTCCAGG - Intergenic
1201783613 Y:17749197-17749219 TTTGTAGGGTGTATGTGTCCAGG - Intergenic
1201817940 Y:18156790-18156812 TTTGTAGGGTGTATGTGTCCAGG + Intergenic
1201932188 Y:19362743-19362765 TTTGGAGGGTGTATGTGTCCAGG - Intergenic
1202040482 Y:20677876-20677898 TTGGGAGGGTGTAGGTGTCCAGG - Intergenic
1202174943 Y:22089464-22089486 TTTGAAGGGTGTATGTGTCCAGG - Intronic
1202216419 Y:22496919-22496941 TTTGAAGGGTGTATGTGTCCAGG + Intronic