ID: 1197148675

View in Genome Browser
Species Human (GRCh38)
Location X:123195961-123195983
Sequence TAACCTTCCCCCAGGCAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197148673_1197148675 -7 Left 1197148673 X:123195945-123195967 CCAGCTTGACTCTAACTAACCTT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1197148675 X:123195961-123195983 TAACCTTCCCCCAGGCAATGCGG 0: 1
1: 0
2: 0
3: 17
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197148675 Original CRISPR TAACCTTCCCCCAGGCAATG CGG Intronic
900324989 1:2104336-2104358 TAACCTTCCCTCAGCCCGTGGGG - Intronic
900721209 1:4176993-4177015 TATCCTCCCCTCAGGCTATGGGG - Intergenic
901207739 1:7506340-7506362 CAACCTTCCCCCTGGGAGTGGGG - Intronic
905011102 1:34747662-34747684 TGACCTTCCACAAGGTAATGAGG - Intronic
907382794 1:54105098-54105120 TAAGTTTCCCCCAGGAAAGGAGG + Intronic
915170217 1:153972496-153972518 TATCCTTCACCCAGACACTGAGG - Intronic
917292150 1:173481464-173481486 TAACCTTGCTCCAGGCAAGATGG - Exonic
920306242 1:205019971-205019993 TCACCATCACCCAGGCAAGGTGG - Exonic
923036795 1:230290152-230290174 TAAACTTCCACCAGGCACAGTGG - Intergenic
1064070170 10:12222036-12222058 TAACCTGTTCCCAGGCAATGTGG + Intronic
1067259344 10:44674377-44674399 TAACCTTCCCCTAGGAAATTAGG + Intergenic
1067971369 10:50974547-50974569 CAAGCATCCCTCAGGCAATGTGG + Intergenic
1068055821 10:52011971-52011993 TTACCTTCCTCCCGGCCATGTGG + Intronic
1072632424 10:97155457-97155479 TAACCTTCCACCAGCCCTTGGGG - Intronic
1073654658 10:105399981-105400003 TTCCCTTCCCCCAGGCTAGGTGG - Intergenic
1073792784 10:106956713-106956735 CAACCTTTCCCCAGTCAGTGTGG - Intronic
1077959555 11:7060260-7060282 TAAACTTTCCTCAGGTAATGAGG + Intronic
1078563952 11:12397798-12397820 AGACCTTCCCCCAGAAAATGGGG - Intronic
1080302972 11:30804887-30804909 TAACTTTCCACCAGGCAAATGGG - Intergenic
1081906860 11:46675705-46675727 TGGCCTTCCTCCAGGCACTGGGG - Intergenic
1083313416 11:61798478-61798500 TAACATTTCGCCAGGCAAGGTGG - Intronic
1084288882 11:68148955-68148977 CAACCTTGCCCCAGGCCAAGTGG + Intergenic
1085306221 11:75487484-75487506 TAACATTTCCCCAGAGAATGAGG - Intronic
1086449076 11:86898537-86898559 TGTCCTTTCCCCAGACAATGAGG - Intronic
1087151128 11:94860819-94860841 TAACCCATCCCAAGGCAATGTGG - Intronic
1087441798 11:98194085-98194107 TCACCTTACCCCAGGCCATTAGG - Intergenic
1088452152 11:109993821-109993843 TAGCCTTCCCCAAAGGAATGTGG + Intergenic
1089164910 11:116468361-116468383 CCAGCTTCCCCCAGGAAATGAGG - Intergenic
1091101637 11:132879985-132880007 TAACCTTCCCCCAGCCCCAGAGG + Intronic
1092188625 12:6500664-6500686 GAAGATTCCCCCAGGCAATTTGG + Intronic
1094528000 12:31245766-31245788 TAAGCTTCACTGAGGCAATGTGG + Intergenic
1094721575 12:33070333-33070355 TTACCTTCCCACCAGCAATGTGG + Intergenic
1097268480 12:57759374-57759396 TGCCCTTCCCCCATGCAATGGGG - Exonic
1101810267 12:108101950-108101972 TTCCCTTCCCCCATGCGATGTGG + Intergenic
1102506043 12:113385104-113385126 AATCCATCCTCCAGGCAATGGGG + Intronic
1102524048 12:113498657-113498679 TCAGCTTCCCCCATGCAAAGTGG - Intergenic
1104762083 12:131303078-131303100 TAAACTTCCCCCAGACAAGGAGG - Intergenic
1104817693 12:131657706-131657728 TAAACTTCCCCCAGACAAGGAGG + Intergenic
1106362687 13:29046945-29046967 TGACCTGACCCCAGCCAATGGGG + Intronic
1106583360 13:31036433-31036455 TAACCTTTCCCCAGCCTAGGGGG + Intergenic
1110711882 13:78659045-78659067 TTACCTTCCCCAAGCAAATGTGG + Exonic
1111811766 13:93100119-93100141 TACCATTTCCACAGGCAATGAGG + Intergenic
1112464795 13:99634543-99634565 TAACCTTCCCCGTGGAAAAGGGG + Intronic
1113888426 13:113724080-113724102 TCACCTCCCCCCAGGCAGGGAGG + Intronic
1116855192 14:49945938-49945960 CAACCTTCTCCCAGTCACTGTGG + Intergenic
1117709877 14:58516383-58516405 TACCCTTCCCCCAGCCAAATAGG - Intronic
1118305391 14:64650891-64650913 TCACCTTCCCCAAGGGAAGGAGG - Intergenic
1119510334 14:75206450-75206472 ATTACTTCCCCCAGGCAATGAGG - Intergenic
1120353997 14:83405112-83405134 TAACTTTCCCCCAAGTAAAGTGG - Intergenic
1123929872 15:25161263-25161285 TAACTTTCCCACAGGCAATATGG - Intergenic
1125771596 15:42171081-42171103 TAACCAGCCCCCAGTCAGTGAGG - Intronic
1128081071 15:64857174-64857196 TAACCTTTTCCCAGGCCTTGTGG + Intronic
1128514850 15:68335706-68335728 TCACCATCCACCAGGCTATGCGG - Exonic
1130934795 15:88459787-88459809 TCAAGTTCCCCCAGGCAATGCGG - Exonic
1132312181 15:100865247-100865269 TGCCCTTCCCCCATGGAATGTGG + Intergenic
1139945162 16:70635963-70635985 TCACCTTGCCCAAGGCAAGGTGG + Intronic
1141322827 16:83027716-83027738 TAAGCTAAGCCCAGGCAATGTGG - Intronic
1141785830 16:86200237-86200259 TTGCCTTCCCCCCTGCAATGCGG + Intergenic
1147361797 17:39935439-39935461 TAAATGTCCCCCAGCCAATGAGG - Intergenic
1151595895 17:75077876-75077898 TAGAGTTCCCCCAGGCACTGGGG + Intergenic
1154398753 18:14014649-14014671 TAAGCTTCCCTTTGGCAATGTGG - Intergenic
1160138603 18:76297488-76297510 TGACCTCCCCCCAAGCAAGGGGG + Intergenic
1160966001 19:1747242-1747264 TACCCCTCCCCCAGGGAATGGGG + Intergenic
1163216895 19:15885749-15885771 TAACCTTTCCCCAGACAGTCAGG + Intronic
1168489552 19:56796652-56796674 TAAAGGTCCCCCAGGCAGTGGGG + Intronic
1168662956 19:58182453-58182475 TAACTGTACCCCAGGCATTGGGG - Intergenic
925118329 2:1398735-1398757 TGCCCTTCCCCCAAGGAATGGGG + Intronic
932673159 2:73755579-73755601 AAACCTTCCCCCAGGCCACCTGG + Intergenic
937742995 2:125377760-125377782 TGATCTTCCCCCAGGTAATAGGG + Intergenic
942010819 2:171761114-171761136 TCACCTTCCCCCAGGTGAAGGGG - Intergenic
945608127 2:211962515-211962537 TAATTTTACACCAGGCAATGGGG + Intronic
1172867851 20:38113512-38113534 AAACATTCCTCTAGGCAATGGGG + Intronic
1173017958 20:39243951-39243973 TTACCTTCCCCCAGGAACTGAGG - Intergenic
1177267580 21:18804466-18804488 TGACCTGACCCCAGCCAATGGGG + Intergenic
1177859679 21:26438128-26438150 TAACCTTCTGCCAGGAAAGGAGG + Intergenic
1184981248 22:48097300-48097322 TTCCTTTCCCCGAGGCAATGGGG - Intergenic
950972689 3:17204333-17204355 TAACTGTCCCCAAGGCAATGTGG + Intronic
952198388 3:31099806-31099828 TCAGCTTCTCCCTGGCAATGGGG - Intergenic
956229507 3:66998254-66998276 TAAGCTTCCCCTGGCCAATGGGG - Intergenic
958871198 3:99561096-99561118 TAATCTAACCCCAGGCAATCTGG + Intergenic
960504619 3:118478003-118478025 CAAGCCTCCCCCAGGCCATGTGG - Intergenic
972140384 4:35951861-35951883 TAGCCTTCTCCCAGACCATGTGG + Intronic
974012855 4:56623422-56623444 ATTCCTTCCCCAAGGCAATGAGG + Intergenic
975563712 4:75732095-75732117 TAACCATCACCCAGGTAGTGAGG + Intronic
975947809 4:79728880-79728902 TCACCTTCCCCTAAACAATGAGG + Intergenic
977304282 4:95303386-95303408 TCAGTTTCCCCCAGGCACTGTGG + Intronic
980409401 4:132396769-132396791 AAACCTTCCCACAGGCATTTAGG - Intergenic
983059824 4:163145823-163145845 TAACCTACCTCCAGTTAATGAGG - Exonic
984333579 4:178358830-178358852 TAATCCTCTCCCAGGGAATGGGG + Intergenic
989322756 5:40156187-40156209 TAACCTTCTGCCAGGACATGTGG + Intergenic
989385985 5:40855019-40855041 TAACTTGCACCCAGGGAATGGGG + Exonic
994471346 5:100211894-100211916 TAACATTCCAACAGACAATGAGG + Intergenic
995381024 5:111533426-111533448 TAACCCTCCCTCAGGAAAGGAGG - Intergenic
995767903 5:115638826-115638848 TAACATTCCAGCAGGCAAGGTGG - Intergenic
997202209 5:132017840-132017862 TACCCTGCTCTCAGGCAATGTGG - Intergenic
997651544 5:135525311-135525333 TACCCTTCCCCCAGGAAATACGG + Intergenic
1004129404 6:12904644-12904666 TATCCTTCCCCAAGTCAAAGAGG - Intronic
1005423960 6:25681812-25681834 TAATTTTCCCCCAGGCAAGTGGG + Intronic
1006155065 6:32009430-32009452 TATCCCACCCCCAGGCAATGAGG - Intergenic
1006161376 6:32042165-32042187 TATCCCACCCCCAGGCAATGAGG - Exonic
1009205881 6:60800883-60800905 TCACCTCACCCCAGGCACTGTGG + Intergenic
1012149832 6:95734429-95734451 TTACCTTCCACCTGGCAAAGGGG - Intergenic
1014074744 6:117223240-117223262 TAAGCTTCTCCCAGGAAATGAGG - Intergenic
1016234949 6:141853611-141853633 TAAGTTTCCCCCAGGGAAAGAGG - Intergenic
1016246467 6:141987046-141987068 CCACCTTCCCCCAGAGAATGAGG + Intergenic
1018436825 6:163767466-163767488 AAACCTTCTTCAAGGCAATGTGG + Intergenic
1018699128 6:166412967-166412989 TCAGCTGCCCCCAGGCAACGTGG + Intronic
1019226693 6:170517116-170517138 TACCGTTGCCTCAGGCAATGGGG - Intergenic
1019678380 7:2329637-2329659 TTTCCTTCCCCCAGGGAATAGGG - Intronic
1020687025 7:11308858-11308880 TAACTCTCCTCAAGGCAATGTGG - Intergenic
1022748387 7:33196897-33196919 TAACCTTCCCCCAGGAACTAAGG - Intronic
1028590471 7:92488043-92488065 TAAATTGCTCCCAGGCAATGTGG - Intronic
1031840014 7:126726482-126726504 AAAGCTTCTCCCAGGCAAGGTGG + Intronic
1032168889 7:129567753-129567775 TTACCATGCCCCAGGTAATGGGG - Intergenic
1034957373 7:155343501-155343523 TAGCCGTCCCCCTGGCAGTGTGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1044942787 8:97360420-97360442 AAACCTTCCACCAGGCCATTTGG + Intergenic
1046651944 8:116845169-116845191 TGAACTTCCCCCAGGTACTGTGG + Intronic
1046980512 8:120331564-120331586 AATCCTTCCACCAGGGAATGAGG + Intronic
1048584710 8:135764192-135764214 CTACCATCCCCCAGGTAATGGGG - Intergenic
1048924329 8:139257302-139257324 TAACTTTCCACCAGGCCATGTGG - Intergenic
1049510748 8:143025572-143025594 TAAGCTTCCACCAGGCCAGGGGG + Intergenic
1049546556 8:143234435-143234457 TAACCCTCCCCCCAGCACTGTGG + Intergenic
1050340719 9:4635708-4635730 AAACCTTAACCCAGGCACTGAGG + Intronic
1056708312 9:88970063-88970085 TAACTTTTCCCCAGGCAAGCAGG - Intergenic
1059255251 9:112924437-112924459 TTCCCTTTCCCCAGACAATGGGG - Intergenic
1059442439 9:114316338-114316360 TAACCATCCCCCAGACAAGCTGG - Intergenic
1060915535 9:127387313-127387335 TCACCTTCCCCCAGGGAAGAAGG - Exonic
1193264407 X:79451899-79451921 TAACTTTATACCAGGCAATGTGG + Intergenic
1193617873 X:83712327-83712349 TTAGCTTCCCACAAGCAATGTGG - Intergenic
1195509679 X:105700492-105700514 TGTCATTCTCCCAGGCAATGGGG + Intronic
1195578983 X:106480463-106480485 TTACTTTCCCCCAGGCGATGAGG + Intergenic
1197148675 X:123195961-123195983 TAACCTTCCCCCAGGCAATGCGG + Intronic
1202258311 Y:22943063-22943085 TAACATTGCCCCAGGAAATCAGG + Intergenic
1202411301 Y:24576821-24576843 TAACATTGCCCCAGGAAATCAGG + Intergenic
1202459480 Y:25093251-25093273 TAACATTGCCCCAGGAAATCAGG - Intergenic