ID: 1197150231

View in Genome Browser
Species Human (GRCh38)
Location X:123212882-123212904
Sequence GTGGACACCCTCACTTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197150231_1197150245 28 Left 1197150231 X:123212882-123212904 CCTAGAGAAGTGAGGGTGTCCAC 0: 1
1: 0
2: 4
3: 10
4: 138
Right 1197150245 X:123212933-123212955 TTCATGACCTGTTAGGAACCAGG 0: 2
1: 42
2: 349
3: 788
4: 1255
1197150231_1197150236 -1 Left 1197150231 X:123212882-123212904 CCTAGAGAAGTGAGGGTGTCCAC 0: 1
1: 0
2: 4
3: 10
4: 138
Right 1197150236 X:123212904-123212926 CAGCAGGGGTCCCCAACCCCTGG 0: 16
1: 118
2: 406
3: 696
4: 1021
1197150231_1197150243 21 Left 1197150231 X:123212882-123212904 CCTAGAGAAGTGAGGGTGTCCAC 0: 1
1: 0
2: 4
3: 10
4: 138
Right 1197150243 X:123212926-123212948 GTACCAGTTCATGACCTGTTAGG 0: 1
1: 20
2: 169
3: 452
4: 966

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197150231 Original CRISPR GTGGACACCCTCACTTCTCT AGG (reversed) Intronic
900337191 1:2170039-2170061 CAGGAGACTCTCACTTCTCTCGG - Intronic
904821531 1:33247921-33247943 CTGGGCACTCTCCCTTCTCTGGG + Intergenic
905198788 1:36302399-36302421 GTGGCCACCATCCCTTTTCTAGG + Intronic
910383077 1:86651015-86651037 GTGGACACCTTCACTTATCTTGG - Intergenic
913325437 1:117624045-117624067 GTGGAAACCCTCAGGTCTCAAGG - Exonic
916941625 1:169684031-169684053 GTCTCCACCCTCTCTTCTCTGGG + Intronic
918051661 1:180978486-180978508 GGGGACCCCCACACTTCTGTGGG + Intronic
1064592844 10:16912600-16912622 CTCCACACCCTCACTTCACTGGG - Intronic
1068404590 10:56573357-56573379 CAGGACACCCCCACTGCTCTTGG + Intergenic
1074827685 10:117226611-117226633 CTGAACACCCTCATTTCCCTAGG - Intergenic
1079569571 11:21925758-21925780 GTGCACACACACACTTCTCTGGG - Intergenic
1080653708 11:34242335-34242357 GAGGACACCCAGACTACTCTAGG + Intronic
1082121661 11:48385617-48385639 GTGCACACCCTCAATTTCCTTGG - Intergenic
1083883240 11:65558479-65558501 CTGCACACCCTCGCTTCTCCAGG - Intronic
1084948744 11:72653167-72653189 GTGGACTCCATCTGTTCTCTGGG + Intronic
1086748680 11:90462646-90462668 GAGGATGCCCACACTTCTCTAGG + Intergenic
1086977326 11:93149538-93149560 GTGCACAGCATCACTTCTGTGGG + Intronic
1089310763 11:117556761-117556783 CTGGACAAGCTGACTTCTCTGGG - Intronic
1089349987 11:117816728-117816750 GTGGAGACGCTCAGTTCTTTGGG + Intronic
1089362874 11:117902552-117902574 GTTGAGACCCTGCCTTCTCTGGG - Intronic
1089414668 11:118277564-118277586 GTGGACCCCCTCACTGAGCTAGG - Intergenic
1090942164 11:131396424-131396446 GTGTACACCTTCACACCTCTCGG + Intronic
1091612146 12:2020087-2020109 GTGCACACACACACTTCTCTTGG + Intronic
1094002744 12:25713425-25713447 TTGGACACCGTCAGCTCTCTTGG + Intergenic
1096164891 12:49414085-49414107 CTGGACACCCAAACTTCTATAGG - Intronic
1100346678 12:93738421-93738443 GTGGGCAGGCTCAATTCTCTAGG - Intronic
1100393922 12:94168382-94168404 GTCGACACTCTCTCTGCTCTGGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101618231 12:106358542-106358564 GTCGACAGCCGCACTTCACTGGG - Intronic
1101654418 12:106707519-106707541 TTGGAAACACTCACTTCTCTTGG - Intronic
1101822235 12:108192825-108192847 TTGCAGACCCTCACTTCCCTGGG + Intronic
1101878180 12:108609042-108609064 GTAATAACCCTCACTTCTCTGGG + Intergenic
1103984862 12:124760475-124760497 GTGAACGACCTGACTTCTCTGGG + Intergenic
1105027139 12:132856870-132856892 GTGGATGCCCTCACTTGCCTGGG + Intronic
1105575147 13:21644085-21644107 ATGGACACCATCACTTTTCTTGG - Intergenic
1112761736 13:102699590-102699612 AATGAAACCCTCACTTCTCTGGG - Intergenic
1115529988 14:34318188-34318210 GAGTACACCCTCACTTTTCTAGG - Intronic
1120082537 14:80232026-80232048 ATGGACAGCCTCACCTCTATTGG - Intronic
1120686421 14:87543072-87543094 GTGGCCACCATCACTCCACTAGG + Intergenic
1129608408 15:77035829-77035851 GTAGACACCCTCATTCCGCTCGG - Exonic
1129645032 15:77421176-77421198 GGGGACACCCTCACTTCCTGTGG + Intronic
1131997129 15:98143735-98143757 GTGTACACCCTTCCTTTTCTGGG + Intergenic
1132623484 16:879235-879257 GTGGACACCCCCACATTCCTGGG - Intronic
1132703184 16:1230603-1230625 GTGGGCACCTTCCCGTCTCTTGG - Intergenic
1132705138 16:1240266-1240288 GTGGGCACCTTCCCGTCTCTTGG + Intergenic
1132708264 16:1255628-1255650 GTGGGCACCTTCCCGTCTCTTGG + Intergenic
1132713447 16:1279215-1279237 GTGGCCACTCCCACTTATCTGGG - Intergenic
1136496796 16:30650089-30650111 GTGGGCACCCCCACTTCTCCAGG + Intergenic
1138999634 16:62494117-62494139 GTGGAGTGCCTCACGTCTCTAGG - Intergenic
1139379398 16:66521113-66521135 GTGGGCACCCTCCCAGCTCTGGG - Intronic
1141906187 16:87028528-87028550 GTGGAAACCCACCCTTCCCTAGG - Intergenic
1142306616 16:89289572-89289594 CTGGACTCCCTCACTTCACAGGG - Intronic
1142751462 17:1990884-1990906 GTGCACACCGTCTCCTCTCTTGG - Intronic
1143298693 17:5892309-5892331 GAAGACATCCTTACTTCTCTAGG - Intronic
1144033408 17:11342172-11342194 TTAGACACCTTCACCTCTCTGGG - Intronic
1145034549 17:19532194-19532216 GTTGACACTCTCAGTTCTTTTGG + Intronic
1149539938 17:57461211-57461233 GTTGTCACCCACTCTTCTCTGGG + Intronic
1150643228 17:66963638-66963660 CTGGACACACTCCCTTCTCCAGG - Intergenic
1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG + Intergenic
1152360261 17:79829904-79829926 CTGGTCTCCCCCACTTCTCTGGG + Intergenic
1152542144 17:80981775-80981797 GAGGACACCTTCTCTTCCCTAGG + Intergenic
1153524301 18:5979981-5980003 GGGGCCACACTCACCTCTCTGGG + Intronic
1153740599 18:8123014-8123036 GTGAACAAGCTCACTTCTCTTGG - Intronic
1157277555 18:46322505-46322527 GTGGCCAGCCTCACTTCTGGGGG + Intergenic
1157312275 18:46561177-46561199 CTGGACCCCCTCTCTGCTCTTGG - Intronic
1159009301 18:63043026-63043048 GTGGACACCCTCGGATATCTAGG - Intergenic
1160548640 18:79679317-79679339 GCCGACAGCCTCACGTCTCTGGG + Intergenic
1160741131 19:686498-686520 GTGGACAGTCTCATTTCTCCTGG + Intronic
1161128881 19:2576470-2576492 GTGGCCACCCTCACACGTCTGGG + Intronic
1161860201 19:6792242-6792264 GAGGCCACCATCACTTCTCATGG - Intronic
1162131542 19:8529138-8529160 CTGGACACCCTCACCTACCTTGG - Intronic
1163573702 19:18098438-18098460 GAGGGCACCCTTGCTTCTCTGGG + Intronic
1163755618 19:19104741-19104763 ATGGAGACCCTCACTATTCTGGG + Intronic
1164408473 19:27976377-27976399 GTGGAAAGCCTCACTGCTGTGGG + Intergenic
1165155671 19:33785892-33785914 GAGGACACCCACCCTTCACTTGG + Intergenic
1165429994 19:35767087-35767109 GTGGAGACCCTCAGTTCTCTGGG + Intronic
926780224 2:16463793-16463815 TTGGACACTCTCACCTATCTGGG + Intergenic
928310051 2:30202132-30202154 CTGGACACACTCACTTGTCTGGG - Intergenic
928959809 2:36912482-36912504 CTGGAAGCCCTCTCTTCTCTTGG + Intronic
932416181 2:71575093-71575115 ATGGACACCCTCACGTCCCATGG - Intronic
932838674 2:75061137-75061159 GTGGACCTCCTCTCTTCTCATGG - Intronic
935220962 2:101012215-101012237 GTGAACACTTTCAGTTCTCTTGG - Intronic
938115593 2:128601359-128601381 GTGCACACCCTCGCTGCTGTGGG + Intergenic
938344733 2:130558970-130558992 GTGGACAGCCTCACTTCTCCAGG - Intergenic
938345100 2:130561750-130561772 GTGGACAGCCTCACTTCTCCAGG + Intergenic
941776263 2:169396714-169396736 CTGGACATCCTCACCTCTCATGG - Intergenic
948117256 2:235502477-235502499 GTGGCCACCCTGAGCTCTCTGGG + Intronic
948265605 2:236633286-236633308 GGTGACACCCTCACTGCTTTGGG + Intergenic
1169813758 20:9634877-9634899 TTGGACACTCACATTTCTCTTGG - Intronic
1172933056 20:38599836-38599858 GTGGGTACACTCACTTCTCCAGG + Intergenic
1173759751 20:45549127-45549149 GTCAGCATCCTCACTTCTCTGGG - Intergenic
1178745694 21:35248221-35248243 CTGGACTCCCTCACATGTCTGGG + Intronic
1179803744 21:43824466-43824488 GGGGACAGCCCCACTGCTCTCGG - Intergenic
1181805208 22:25370415-25370437 GTGGTCACCATCTCTGCTCTTGG - Intronic
1183474874 22:38030701-38030723 AGGCACATCCTCACTTCTCTGGG + Intronic
1184085562 22:42261311-42261333 GTGGACATTTTCATTTCTCTTGG + Intronic
950651031 3:14406805-14406827 GTGGCCAACCACCCTTCTCTTGG + Intronic
955036714 3:55274986-55275008 GTGTAGACCCACTCTTCTCTGGG + Intergenic
956178624 3:66498419-66498441 GAGGACACCCTGCCCTCTCTGGG + Intronic
956728796 3:72177962-72177984 ATGGACACCCTCACTGCACAGGG + Intergenic
959420906 3:106127149-106127171 GTGCACATCCTCCCTTCTTTAGG - Intergenic
960946476 3:122970204-122970226 GAGGGCACCATCACTTCTCAGGG + Intronic
961415887 3:126756393-126756415 GTGGACACCCTCCCTTCAGGAGG - Intronic
961993835 3:131219921-131219943 GTGGGCTACTTCACTTCTCTGGG - Intronic
962274227 3:134000131-134000153 GATGTCACCCTCCCTTCTCTTGG - Intronic
962276254 3:134016694-134016716 GTGGACATTTTCATTTCTCTAGG - Intronic
968751776 4:2393737-2393759 CTGGACACCCCCAGTTCACTCGG + Intronic
969423736 4:7111846-7111868 GTGGGCACCCTCTCTTTCCTGGG + Intergenic
969466776 4:7361947-7361969 GGGGGCATGCTCACTTCTCTTGG + Intronic
970828375 4:20305924-20305946 GTGGGCACCATAACTTCTTTAGG - Intronic
972284892 4:37638628-37638650 GGGGAGACCCTCCTTTCTCTAGG - Intronic
974793082 4:66714621-66714643 GTGGACCCCCTCTCTCCTGTGGG - Intergenic
975310912 4:72902925-72902947 GGGGATACCCTCCCTTGTCTAGG - Intergenic
976238090 4:82922052-82922074 GTGGACATTTTCATTTCTCTTGG - Intronic
977730483 4:100345138-100345160 TTGGACAACTTAACTTCTCTGGG + Intergenic
985355650 4:189116488-189116510 GTGGACACCCTCAGTCCCCAGGG + Intergenic
985867300 5:2524008-2524030 GTGCACACCCTCACTGCCCCAGG - Intergenic
986377150 5:7143988-7144010 GTGGCCACCTCCACTCCTCTGGG + Intergenic
986383148 5:7206585-7206607 CTGGACACCCCCACTACTGTGGG + Intergenic
998070038 5:139190630-139190652 GTGGCCCACTTCACTTCTCTGGG + Intronic
1000970940 5:167714044-167714066 GAGGTGACCCTCACTTCTTTAGG - Intronic
1007112375 6:39320329-39320351 CTGGAGACCCTCACTTCTGGGGG + Intronic
1008767167 6:54932667-54932689 GTGAACTCCCTCATTTATCTGGG + Intronic
1018294949 6:162335823-162335845 TTGGCCACCCTCGCTTCACTCGG - Intronic
1020086294 7:5312623-5312645 GTGGACGCCCTCTCTCTTCTTGG + Exonic
1023885161 7:44349055-44349077 GTGAACACCCTTATGTCTCTGGG - Intergenic
1024007909 7:45241096-45241118 TGGGACACCCTCTCTTCCCTGGG - Intergenic
1025208013 7:57004449-57004471 GTGGACGCCCTCTCTCTTCTTGG - Intergenic
1025663940 7:63572426-63572448 GTGGACGCCCTCTCTCTTCTTGG + Intergenic
1029626066 7:101720885-101720907 GTGGACAACCTCGCTTCCCCAGG + Intergenic
1029631195 7:101751688-101751710 GAGGACAGCCTCTCTCCTCTAGG - Intergenic
1035789617 8:2292182-2292204 GTTGACAGCCTCCCTTCTATAGG + Intergenic
1035803188 8:2429523-2429545 GTTGACAGCCTCCCTTCTATAGG - Intergenic
1036668256 8:10762524-10762546 GTGGAGACTCTCTTTTCTCTAGG - Intronic
1037652545 8:20852044-20852066 GTGTACACCCTTATTTCTCCAGG + Intergenic
1038320948 8:26526876-26526898 GAGGACACCCTCACTTCCTTGGG - Intronic
1041233089 8:55773029-55773051 GTGGAGATCCTCCCTCCTCTGGG - Intronic
1047501460 8:125445064-125445086 GTGGAGACCCTTACCTCTTTTGG + Intergenic
1048370433 8:133771991-133772013 TTAGAGACCCTCTCTTCTCTGGG - Intergenic
1049232936 8:141493600-141493622 GTGGCCTCATTCACTTCTCTGGG + Intergenic
1049287239 8:141782447-141782469 GAGGAAACCCTCACTTGTATGGG + Intergenic
1049377114 8:142294541-142294563 GTGGGCACCCTGCCTCCTCTGGG + Intronic
1054957988 9:70935155-70935177 GAGGACTTCCCCACTTCTCTGGG + Intronic
1056828234 9:89891429-89891451 GTGGCCAGCCTCCCTTCTCATGG - Intergenic
1057801408 9:98193180-98193202 GAGGACGCCCTTCCTTCTCTCGG + Intergenic
1059473695 9:114526728-114526750 GTAGACACCCTCTCTTGCCTGGG + Intergenic
1189654233 X:43225073-43225095 ATGGGCATCCTCACTTATCTTGG - Intergenic
1193560127 X:83008277-83008299 GTGGAAACCCTAACTGCTCTTGG + Intergenic
1196150760 X:112370793-112370815 TTGTACACCTTCACTCCTCTTGG + Intergenic
1197150231 X:123212882-123212904 GTGGACACCCTCACTTCTCTAGG - Intronic
1200063749 X:153495203-153495225 GTGGACACCCTCGCGGCACTGGG - Intronic
1201060081 Y:10037182-10037204 GTGGACACGCCCACCTCTCAAGG + Intergenic
1201324780 Y:12744515-12744537 GTGGAAACCCTGACTGCTGTTGG + Intronic