ID: 1197151100

View in Genome Browser
Species Human (GRCh38)
Location X:123220758-123220780
Sequence TGACACTACTTCCTACTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197151099_1197151100 -2 Left 1197151099 X:123220737-123220759 CCTCTTTTTATCAAATAGGGATG 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1197151100 X:123220758-123220780 TGACACTACTTCCTACTTCATGG 0: 1
1: 0
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197151100 Original CRISPR TGACACTACTTCCTACTTCA TGG Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
902935378 1:19761231-19761253 TGGCCCTCCTTCCCACTTCATGG - Intronic
903279275 1:22241246-22241268 TGTCACTACCTCCTTTTTCATGG + Intergenic
905927503 1:41762410-41762432 TGACACTGCTTCCTGCTGCATGG - Intronic
906688225 1:47776376-47776398 TAATAATACTACCTACTTCATGG + Intronic
906966826 1:50465856-50465878 TGAAACATGTTCCTACTTCAGGG - Intronic
908661753 1:66444712-66444734 TGATACTACTGCCTAGCTCAAGG + Intergenic
908676683 1:66612314-66612336 TGGCACCACTTCCAACATCAGGG + Intronic
908771830 1:67604450-67604472 GGATAATACTTCCTACCTCATGG - Intergenic
909284102 1:73792636-73792658 AGACACTACTTGATAATTCAAGG + Intergenic
910713166 1:90202835-90202857 TAACAATAATGCCTACTTCACGG - Intergenic
912496093 1:110092674-110092696 TGACACTCCGTCCCACCTCAGGG + Intergenic
914940203 1:152015895-152015917 GGACACCACTGCCAACTTCAGGG + Intergenic
923294991 1:232585565-232585587 CAAAACTACTTCCTACTCCAAGG + Intergenic
1063013058 10:2044616-2044638 TGAGGCCAGTTCCTACTTCAGGG + Intergenic
1063206292 10:3834085-3834107 TGATGCTACTATCTACTTCATGG + Intergenic
1063218971 10:3948849-3948871 AGACCCTACTTCCTCCTCCAGGG - Intergenic
1063814609 10:9758195-9758217 TGACCCTCCTTCCTAGTCCAAGG - Intergenic
1066601266 10:37109934-37109956 TCACACTTATTTCTACTTCAAGG + Intergenic
1069809526 10:71148127-71148149 TCACACAACTGCCTCCTTCAGGG + Intergenic
1070390479 10:75966348-75966370 TGAAAATACCTCCTACTTTATGG + Intronic
1071520077 10:86325283-86325305 GGACAGTAGTGCCTACTTCATGG - Intronic
1074236999 10:111595019-111595041 TGACATTACTACCTACTGCATGG - Intergenic
1074415961 10:113266900-113266922 TGATTCTTCTTCCTTCTTCATGG + Intergenic
1078634525 11:13036626-13036648 AGATAACACTTCCTACTTCAGGG + Intergenic
1078791619 11:14548357-14548379 TGTCACTACTTCAGACTTCTTGG + Intronic
1078831608 11:14982708-14982730 TGAGACAACTTCCCACATCATGG - Intronic
1079137469 11:17784026-17784048 TGACAGTACTCACTACTCCACGG - Intergenic
1079674617 11:23210604-23210626 TGACACTAGATCCATCTTCAAGG - Intergenic
1080264409 11:30386386-30386408 GGACACTGCTTCCTGCATCATGG + Intronic
1081043678 11:38244376-38244398 TGACTGTACCTCCTACTTGAAGG + Intergenic
1086269266 11:85040862-85040884 TAATACTAGTTCCTACTTTATGG - Intronic
1087773481 11:102236652-102236674 AGACACTTCCTCCTCCTTCAGGG + Intergenic
1090346978 11:126079466-126079488 TAACACTACTGCCTGCCTCATGG + Intergenic
1090512756 11:127393137-127393159 TAACACTATTTTCTACTTCTTGG + Intergenic
1090638739 11:128712118-128712140 TGACACTAATTCCTTCACCAGGG - Intronic
1091095365 11:132816168-132816190 TGATACTGATTCCAACTTCATGG + Intronic
1091236180 11:134023880-134023902 GGACAAAACTACCTACTTCATGG - Intergenic
1091758751 12:3073400-3073422 TGATGCTACTACCTACCTCATGG + Intergenic
1093942450 12:25069328-25069350 TAACTCTACTTCCTACTGCCAGG + Exonic
1094746907 12:33354964-33354986 TGACATTACTTCTTTCTCCATGG - Intergenic
1096857407 12:54494190-54494212 TGATAATACTTCCTATTTCACGG - Intergenic
1097096395 12:56552244-56552266 TGAGACTACTTCCCACCTCCAGG - Intronic
1099895049 12:88634643-88634665 TGACATTACTTTCTTCATCAGGG + Intergenic
1100097638 12:91062326-91062348 TGTCATAACTTCCTACTTCAAGG + Intergenic
1101662715 12:106780094-106780116 TGATACTACTCCATACCTCAGGG - Intronic
1101899197 12:108778679-108778701 TGACAATGCTACCTACTTCATGG - Intergenic
1104220789 12:126783154-126783176 TGTAACTAAATCCTACTTCATGG - Intergenic
1106228762 13:27805519-27805541 TTACAATAATTCCTACTTCATGG - Intergenic
1108508843 13:51136709-51136731 TGTCACTTTTTCCTTCTTCAGGG - Intergenic
1109701267 13:66027431-66027453 TGAAATTACTTCTTAATTCATGG - Intergenic
1109996016 13:70127940-70127962 TAACACTCCTTCCTGCTTTAAGG + Intergenic
1111101416 13:83593186-83593208 AGACACTAGTACCTACTTGAGGG - Intergenic
1111820188 13:93204496-93204518 TCACTCTACTTCCCTCTTCATGG - Intergenic
1112018554 13:95351795-95351817 TCATACTTCTTCCTACCTCATGG - Intergenic
1112851660 13:103713484-103713506 TGAAAATACTACCAACTTCATGG + Intergenic
1115853913 14:37609543-37609565 TGATAATACTGCCTAGTTCATGG + Intronic
1116455920 14:45120673-45120695 GGACAGTACTGCCTACCTCAAGG - Intronic
1118470206 14:66068209-66068231 AGACACGACTCCCAACTTCAAGG + Intergenic
1119240468 14:73055468-73055490 TCACAATAGTTCTTACTTCAGGG + Intergenic
1121927182 14:97938366-97938388 TGCCACAACTCCCTACTACATGG - Intronic
1124148004 15:27148124-27148146 AGACACTACTACTGACTTCATGG + Intronic
1126238548 15:46414461-46414483 TAACACAACTTCTTACTTGATGG + Intergenic
1126311590 15:47323194-47323216 TAACACTCCTTCCTACTACCTGG - Intronic
1127163641 15:56219524-56219546 AGACACTAGGTCCTACTTGAGGG - Intronic
1127927204 15:63558341-63558363 GGACAGTAGTTCCTACCTCATGG + Intronic
1128647384 15:69387577-69387599 TGACACTAGGACCTACCTCAGGG - Intronic
1129081415 15:73044501-73044523 TGACTTTGCTGCCTACTTCATGG + Intergenic
1129784294 15:78298927-78298949 ATACACTACCTCTTACTTCAGGG + Intronic
1132260832 15:100423581-100423603 AGACACTAGGTCCTACTTGAGGG + Intronic
1134655883 16:15948346-15948368 TAATACTACTTCTTACCTCATGG + Intergenic
1135086431 16:19478241-19478263 TGACTCTACTTCCAACCCCAGGG - Intronic
1135185189 16:20309554-20309576 TCACATCACTTCCTAATTCAGGG - Intronic
1136996935 16:35197044-35197066 TGACAGTGCTTCATACATCATGG - Intergenic
1137023610 16:35453176-35453198 TGACAGTGTTTCCTACATCATGG - Intergenic
1137063524 16:35813337-35813359 TGACACGATTTCCTTTTTCATGG - Intergenic
1141128477 16:81418028-81418050 AGACACCAGTTCCTACTTGAGGG - Intergenic
1143156793 17:4842413-4842435 AGGAACTACTTCCTACTTCATGG - Intronic
1143270544 17:5671861-5671883 TAACAGTAATACCTACTTCAGGG - Intergenic
1145355136 17:22138051-22138073 TGACAATCTTTCCTAATTCAAGG + Intergenic
1149198083 17:54147696-54147718 AGACACTAGTGCCTACTTGAGGG - Intergenic
1149580129 17:57744066-57744088 TGACAATAATTCCTGCTCCATGG + Intergenic
1149977119 17:61277426-61277448 AGACACTACTGCCTAATCCATGG - Intronic
1151586778 17:75013598-75013620 TGGCACTACTTCTTCCTTCTTGG - Intronic
1151783479 17:76263142-76263164 TGACAGTACTTCCTTCTTCTGGG + Intergenic
1158327659 18:56328291-56328313 GGACTCTACTTCCTACTCCAAGG + Intergenic
1158648391 18:59266954-59266976 TTACAGAACTTCCAACTTCATGG - Intergenic
1159204063 18:65227423-65227445 ACACACTACTGCCTAGTTCATGG - Intergenic
1159299968 18:66550625-66550647 TGACACTCCTTGCTGCTTCTGGG + Intronic
1162424199 19:10584149-10584171 TGACCCTACTTCCTAGCTGAGGG + Intronic
1162559452 19:11407579-11407601 TGATACGACTTCCTGGTTCAGGG + Intronic
1163228284 19:15980103-15980125 TGACAACACTACCTACCTCAGGG - Intergenic
1167132508 19:47596366-47596388 TGACAACAGCTCCTACTTCAAGG + Intergenic
926599932 2:14831482-14831504 TGACACTACTTAATAATGCAGGG + Intergenic
927969270 2:27294589-27294611 TAAGACTATTACCTACTTCAGGG + Intronic
929377904 2:41312955-41312977 TGGCAGTATTTCCAACTTCATGG - Intergenic
931687441 2:64806542-64806564 TGATACTAGTGCCTACCTCACGG + Intergenic
932017096 2:68040544-68040566 TGACATAACTTCCTAATTCCAGG + Intergenic
932087286 2:68773788-68773810 TGACTTTACTTCCTACTAAAAGG - Intronic
935335736 2:102014289-102014311 TAATAGTAATTCCTACTTCATGG + Intronic
937401592 2:121588604-121588626 GGAGACTACTGCATACTTCATGG - Intronic
942347416 2:175017896-175017918 TGACACTGCTTCCTGCATCCAGG + Intergenic
942857389 2:180565733-180565755 TCTCACTTCTTCCTAATTCATGG - Intergenic
944782681 2:203035642-203035664 AGATAATACTTCCTACCTCATGG - Intronic
1170302382 20:14898856-14898878 TGATACTACTTCCTATTTGTTGG - Intronic
1173550978 20:43932967-43932989 TGCCTCTACTTCCTTCTTGAAGG - Intronic
1173880940 20:46411785-46411807 TAACAATAATTCCTAATTCAGGG - Intronic
1176888432 21:14284553-14284575 TGACACTTCTTCCTGCTGCCAGG - Intergenic
1177912273 21:27047788-27047810 TGAAACTATTTGCTACCTCATGG - Intergenic
1178186755 21:30230906-30230928 TGACAAAACTTCCTGCTTCCAGG + Intergenic
1182239497 22:28903747-28903769 TTCCACTCCTTCCTACGTCAAGG + Intronic
1182694339 22:32186393-32186415 TGTGACTACTACCTACCTCATGG - Intergenic
1182904523 22:33923536-33923558 GGTAACTACATCCTACTTCAGGG - Intergenic
1183793424 22:40094129-40094151 TGACAGTAGTACTTACTTCATGG + Intronic
1183812074 22:40265961-40265983 TGTCACTACTTCCTGCTTTGTGG - Exonic
1184326576 22:43792100-43792122 TGACCTGACTTCCTAGTTCAAGG - Intronic
949399615 3:3652167-3652189 TCACACTCTTTCCTACATCAGGG + Intergenic
950152422 3:10698021-10698043 GGACACTCCCTCCTACTTCCTGG + Intronic
950267821 3:11588342-11588364 TGGCACTTCCTCCTGCTTCAAGG - Intronic
951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG + Intronic
952987055 3:38794843-38794865 TGACCATATTTCCTAGTTCATGG + Intergenic
955858603 3:63301790-63301812 TGTCACTTCTTCATACTTCTGGG + Intronic
957461493 3:80526871-80526893 TGGCTCTACTTCCTGCTTCATGG - Intergenic
958094605 3:88927592-88927614 AGACACTAATTCCTATTTCAAGG - Intergenic
959291564 3:104481174-104481196 TGAAATTACTTCTTAATTCATGG - Intergenic
962684161 3:137830444-137830466 TGAAACCAATTGCTACTTCAAGG - Intergenic
962850776 3:139306872-139306894 TGAAACAGCTTCCTACTCCAGGG + Intronic
962878047 3:139551011-139551033 GGACACTACTACCTGCTTCCAGG + Intergenic
963062673 3:141237528-141237550 TGATAATAATACCTACTTCATGG + Intronic
969970161 4:11038560-11038582 TGCCACCACTTCCTCCTACATGG + Intergenic
971598595 4:28564316-28564338 TGAAACTACTTCCAACTTAGTGG - Intergenic
971664322 4:29462166-29462188 TGACACTACTGACTACTAGAGGG + Intergenic
972843029 4:42953906-42953928 AGACACTAGTGCCTATTTCATGG - Intronic
975077853 4:70235295-70235317 TGCCACCTCTTCCTTCTTCAGGG - Intergenic
975491493 4:74994104-74994126 TCACACGAATTCCTACTTCTTGG - Intronic
975969882 4:80020544-80020566 TGAAACTACTATTTACTTCAAGG - Intronic
976728431 4:88239513-88239535 TGACTCTAGTCCCTAGTTCATGG - Intergenic
976778937 4:88737480-88737502 CGAAACTGCTTCCTTCTTCAAGG - Exonic
977572066 4:98639003-98639025 AGACACTACTTCATCCCTCAAGG + Intronic
978026433 4:103880660-103880682 TGACATTGCTTCCTCCCTCAAGG - Intergenic
980479454 4:133368865-133368887 AGACACTGCTGCCTACTTCAGGG + Intergenic
981732681 4:147916350-147916372 TGACAATACTTACTATTTTATGG + Intronic
982530659 4:156538723-156538745 TGAAGCTAGTTCCTACTACAGGG - Intergenic
983175052 4:164578463-164578485 TGACACTACTCCCAAGTACAAGG + Intergenic
983626755 4:169809402-169809424 TGGCAGTACTTCCTGCTTGAAGG + Intergenic
984496482 4:180504506-180504528 TGTCATTACTTCATACTTCTCGG + Intergenic
984996368 4:185434394-185434416 TGTCACTACTTTCTTTTTCATGG + Intronic
987368346 5:17170426-17170448 TGATATTACTTCCTACTTCTGGG - Intronic
987957967 5:24764623-24764645 TAACAATAATTCCCACTTCAAGG - Intergenic
988654320 5:33191184-33191206 AGACACTACTGCTGACTTCAAGG - Intergenic
989575555 5:42984569-42984591 TGACTGTACTTCCTGCTTCCTGG + Intergenic
991154315 5:63413050-63413072 TAACAATAGTCCCTACTTCATGG + Intergenic
992216789 5:74533014-74533036 TGAAATTACTTCTTAATTCATGG - Intergenic
993314638 5:86386257-86386279 TGACACTACTACCTATATTAAGG + Intergenic
995708122 5:115006354-115006376 TGAATCTGCTTCCTACTTCTTGG - Intergenic
995909806 5:117172730-117172752 TTCCACTACTTCCTGCTTCCTGG - Intergenic
997075342 5:130668198-130668220 TGAAAATGCTCCCTACTTCATGG + Intergenic
997378464 5:133416645-133416667 TGACATAAATTCCTACTTGATGG + Intronic
998383702 5:141743705-141743727 TAACACCACTTCCTTCTTCCTGG - Intergenic
1001430882 5:171660955-171660977 TGCTACTCCTTCCTACTTCATGG - Intergenic
1003988359 6:11460637-11460659 GGACAGTAATTCCTATTTCATGG + Intergenic
1005495856 6:26387388-26387410 TGACACTTCTGTCTAGTTCAGGG - Intronic
1006698531 6:35952672-35952694 TTAAACTTCTTCCTAATTCATGG - Intronic
1008226171 6:48919792-48919814 GGACACTGCTTCCTACATCCTGG + Intergenic
1008397710 6:51027971-51027993 TGACACTAGGGCCTACTTGAAGG - Intergenic
1010241329 6:73618420-73618442 GAGCACTAATTCCTACTTCATGG + Intronic
1012325980 6:97918010-97918032 TGACACTGCTTCATAAATCAGGG - Intergenic
1013806667 6:114003910-114003932 TCAAACTATTTCCTTCTTCAAGG - Intronic
1014392254 6:120877230-120877252 TTACAACCCTTCCTACTTCAAGG - Intergenic
1014946960 6:127510332-127510354 TGTGACTATTTCCTCCTTCAGGG - Intronic
1015812102 6:137171172-137171194 TGAGACTAATTCCTAGTTTATGG - Intronic
1016850273 6:148612093-148612115 AGAGAAAACTTCCTACTTCATGG + Intergenic
1017052877 6:150409563-150409585 TCACAATAGTCCCTACTTCATGG + Intergenic
1017233010 6:152092788-152092810 TCTCAATACTTCTTACTTCACGG + Intronic
1017884291 6:158586440-158586462 TAACAGTAGTTTCTACTTCATGG - Intronic
1022748749 7:33201765-33201787 AGACACGACTTCCTGCTTTAAGG - Intronic
1022881594 7:34593748-34593770 ATACACTAATTTCTACTTCATGG - Intergenic
1023322862 7:39018297-39018319 ATTCCCTACTTCCTACTTCATGG - Intronic
1027870799 7:83705012-83705034 TGATATAACTTCCTACTTTATGG - Intergenic
1029343085 7:99960165-99960187 TGACATTATTTCCCACATCACGG + Intergenic
1029433625 7:100548666-100548688 TGAAGCTACTTCCTAATTCCAGG - Intronic
1031034047 7:116767545-116767567 TGACAATAATACCTACTTCAGGG + Intronic
1032459025 7:132095648-132095670 TGACACAACTTTATGCTTCAAGG - Intergenic
1039383788 8:37112105-37112127 AGACACTAGGTCCTACTTGAGGG + Intergenic
1040683603 8:49843216-49843238 TGACATTACTTTCTGTTTCAGGG - Intergenic
1041181175 8:55250019-55250041 TGACACAACTTCCTAATGCTAGG - Intronic
1041395762 8:57389636-57389658 TGACACTGCATCCTCCATCATGG + Intergenic
1042106908 8:65337852-65337874 TCACACTCCTTCCAGCTTCAGGG - Intergenic
1044307593 8:90656024-90656046 AGACACTAGTACCTACTTGATGG + Intronic
1044547218 8:93473183-93473205 TTACACTACTTGCAAGTTCAGGG - Intergenic
1047335345 8:123930701-123930723 TGACACTAGTGCCTGCTTCAGGG + Intronic
1047601675 8:126431972-126431994 TGACAAGACTTCTTCCTTCAGGG + Intergenic
1052173030 9:25425585-25425607 GGACACTGCTTCCTACATCTTGG + Intergenic
1052381314 9:27773933-27773955 GGACTCTACTTCCTTCTTAAGGG + Intergenic
1052940023 9:34125951-34125973 GGAGACTACTTCCTTCTTCCAGG + Intronic
1052976032 9:34410877-34410899 TAACACTAATACCTAGTTCAAGG + Intronic
1055040019 9:71859522-71859544 TGTTACTACTTCTTACTTCAGGG + Intergenic
1055742318 9:79403459-79403481 TTTCAATCCTTCCTACTTCAGGG - Intergenic
1055874307 9:80923837-80923859 TGACACAACTACCTACCTCAAGG + Intergenic
1057517684 9:95735934-95735956 TGAAACTAGTTCCTAGATCAAGG + Intergenic
1061703352 9:132433178-132433200 TGACAATAGCACCTACTTCATGG + Intronic
1188485138 X:30674303-30674325 TAACCCTACCTCCTGCTTCATGG + Intronic
1190396929 X:49994378-49994400 TGCCACTTCTTCCTTCCTCAAGG - Intronic
1192799416 X:74451625-74451647 TCACCCTACTTCATAGTTCATGG - Intronic
1193906112 X:87246224-87246246 GGACACTAATACCTACTTGATGG - Intergenic
1194755944 X:97740089-97740111 CCACACTACTTCCATCTTCATGG - Intergenic
1195464972 X:105170548-105170570 TGACACTTGTGACTACTTCATGG - Intronic
1196764029 X:119226724-119226746 TGACCTTGCCTCCTACTTCATGG + Intergenic
1197072865 X:122321644-122321666 TCACCCTAGTTCCTAGTTCACGG - Intergenic
1197151100 X:123220758-123220780 TGACACTACTTCCTACTTCATGG + Intronic
1197943671 X:131815644-131815666 TGACAATGCTTCCCACCTCACGG + Intergenic
1199219158 X:145297174-145297196 TGACTCTACGTCCTGCTTCCTGG + Intergenic
1199449224 X:147960998-147961020 TGACACAGCCTCCTTCTTCAAGG + Intergenic