ID: 1197153681

View in Genome Browser
Species Human (GRCh38)
Location X:123247371-123247393
Sequence TTTATAGTCCCCGAGTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197153681_1197153685 27 Left 1197153681 X:123247371-123247393 CCTACAGACTCGGGGACTATAAA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1197153685 X:123247421-123247443 TGCTTGCCACTCACCATTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 81
1197153681_1197153682 -5 Left 1197153681 X:123247371-123247393 CCTACAGACTCGGGGACTATAAA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1197153682 X:123247389-123247411 ATAAATAAAAGCGTGACAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 219
1197153681_1197153686 28 Left 1197153681 X:123247371-123247393 CCTACAGACTCGGGGACTATAAA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1197153686 X:123247422-123247444 GCTTGCCACTCACCATTGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197153681 Original CRISPR TTTATAGTCCCCGAGTCTGT AGG (reversed) Intronic
901629156 1:10640020-10640042 TTTTTGGCCCCCGAGGCTGTCGG + Exonic
902608920 1:17585710-17585732 TTTCTAGTCCAAGAGACTGTTGG + Intronic
902644785 1:17790744-17790766 TTCATAGTGCCCCAGGCTGTAGG + Intronic
902961390 1:19965554-19965576 TTTAAGCTCCCCCAGTCTGTGGG + Intergenic
908762147 1:67522334-67522356 TTTATAACCCCTGAGTCTGGGGG + Intergenic
911748287 1:101465899-101465921 TTTATTATCTCAGAGTCTGTGGG + Intergenic
916472260 1:165135965-165135987 TTCATAGTCCCCAAGAGTGTAGG - Intergenic
917345059 1:174021710-174021732 TTTTTGGACCCCTAGTCTGTGGG - Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1069881923 10:71598537-71598559 GTTACAGACCCCTAGTCTGTCGG - Intronic
1085153103 11:74267968-74267990 GTTATAGGCTCCCAGTCTGTTGG + Intronic
1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG + Intronic
1087981777 11:104623075-104623097 TTGATAGTTCTCGTGTCTGTGGG - Intergenic
1090532943 11:127610052-127610074 TTTATTGGCCCCCAGTCTGCAGG + Intergenic
1090760618 11:129833950-129833972 GTTTAAGTCCCCTAGTCTGTGGG + Intronic
1094427519 12:30330500-30330522 TTTATAGCCCCAGAGTCCCTTGG - Intergenic
1097131260 12:56812131-56812153 TTTATAGTCCCACAGTCAGTGGG - Intergenic
1101272433 12:103161984-103162006 TTTATATTCCCCAAACCTGTGGG - Intronic
1116966706 14:51022460-51022482 TTTATAATCACCCAGTCTGTGGG + Intronic
1119292496 14:73506713-73506735 TTTATGATCCCAGAGTCAGTTGG - Intronic
1121103895 14:91268264-91268286 TTTATAGTCACAGAGTCTTCTGG - Intergenic
1121177266 14:91899907-91899929 TTTGTTGTCCCCGAGATTGTTGG - Intronic
1131105884 15:89734228-89734250 TGTTTAGTCCTTGAGTCTGTAGG + Intronic
1136125251 16:28174767-28174789 TTTATAGTCTCAGTGACTGTAGG - Intronic
1140134527 16:72194031-72194053 TTTATAGTCCCCTGATCTCTTGG + Intergenic
1155901723 18:31398732-31398754 ATTATAGTCGCCGGGTCTGGTGG - Intronic
1156093856 18:33505527-33505549 TTTACAGTCTCCTAGGCTGTTGG - Intergenic
925995309 2:9287972-9287994 TTTATAGTCAGCCAGTCTGTGGG + Intronic
930943009 2:57036077-57036099 TTGATGGTCCCCCTGTCTGTTGG - Intergenic
933215292 2:79622817-79622839 TTTTTAATGGCCGAGTCTGTAGG + Intronic
933945364 2:87281687-87281709 TTTATAGCCCCCGAGTCCTCTGG + Intergenic
935568485 2:104634752-104634774 ATTATAGTCCCCCAGTATGCTGG + Intergenic
936334845 2:111579904-111579926 TTTATAGCCCCCGAGTCCTCTGG - Intergenic
941352303 2:164451632-164451654 TTTGTACTCCTCGAGTCTGCAGG - Intergenic
1169433828 20:5566181-5566203 TTTATATTCCCAGAGACTGATGG - Intronic
1178380586 21:32104316-32104338 TTTGAAGCCCCCAAGTCTGTGGG + Intergenic
957129824 3:76208776-76208798 TGTATAATCCCCGGGTCTGGGGG + Intronic
972239308 4:37172893-37172915 TTTCTAGTCCCTGAGTATATCGG + Intergenic
973242151 4:47968651-47968673 TTTCTAGTCCCAGATCCTGTGGG - Intronic
974424433 4:61722875-61722897 TTAATAGTCCCAGAGTTTGGAGG - Intronic
978146749 4:105383112-105383134 TTTATGGTTCCCTAGTGTGTTGG + Intronic
984874388 4:184354411-184354433 TTTATGCTCTCAGAGTCTGTGGG - Intergenic
986516432 5:8569320-8569342 TTTATAGTTTCAAAGTCTGTTGG - Intergenic
991231275 5:64335268-64335290 GTTATTGTCTCCCAGTCTGTGGG + Intronic
1011978449 6:93338108-93338130 TTTCTACTCCCAGAGGCTGTTGG - Intronic
1019509341 7:1409585-1409607 TTTATAGTTCCACAGTCTGGAGG + Intergenic
1023081764 7:36533099-36533121 GCTATAGTCCCAGAATCTGTGGG + Intronic
1030620615 7:111786258-111786280 TTTAGAGCCCCCAAGACTGTAGG + Intronic
1031434249 7:121713066-121713088 TTTATAGACTCCAACTCTGTGGG - Intergenic
1041904630 8:63018698-63018720 TTCCTAGTCCCCCAGCCTGTGGG - Intronic
1049842921 8:144785632-144785654 TTTATATTTCCCCAATCTGTGGG - Intronic
1050671980 9:8007969-8007991 TCTATAGGCTCCAAGTCTGTGGG - Intergenic
1050993766 9:12187182-12187204 TTTATAATTACCCAGTCTGTGGG - Intergenic
1052097882 9:24406725-24406747 TTTATAAGCCACGAGACTGTGGG + Intergenic
1053040488 9:34866532-34866554 TTTATAGGCCCTGGTTCTGTTGG - Intergenic
1055509429 9:76981001-76981023 TATATAAACCCCCAGTCTGTGGG + Intergenic
1189991156 X:46596423-46596445 TTTATAATCCCTGGGTCTGGGGG + Intronic
1192147237 X:68689770-68689792 GTGATAGTCCCCTAGGCTGTGGG + Intronic
1196644438 X:118101667-118101689 TTTATAATCCCCAAGTGTGGAGG + Intronic
1197153681 X:123247371-123247393 TTTATAGTCCCCGAGTCTGTAGG - Intronic
1198462479 X:136876997-136877019 TTTATAGTGGCCGAGCCTGGTGG - Intronic
1200939391 Y:8766264-8766286 TTTTGAGTCTCCAAGTCTGTTGG - Intergenic