ID: 1197154317

View in Genome Browser
Species Human (GRCh38)
Location X:123253461-123253483
Sequence AGAATAGCGCCCTTCAAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197154317_1197154321 2 Left 1197154317 X:123253461-123253483 CCAGCCTTGAAGGGCGCTATTCT 0: 1
1: 0
2: 0
3: 7
4: 53
Right 1197154321 X:123253486-123253508 GTCTTCTGGGTCATTACAAGTGG 0: 1
1: 0
2: 1
3: 5
4: 91
1197154317_1197154322 3 Left 1197154317 X:123253461-123253483 CCAGCCTTGAAGGGCGCTATTCT 0: 1
1: 0
2: 0
3: 7
4: 53
Right 1197154322 X:123253487-123253509 TCTTCTGGGTCATTACAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197154317 Original CRISPR AGAATAGCGCCCTTCAAGGC TGG (reversed) Exonic
901419067 1:9137967-9137989 AGAATTCTGCCCATCAAGGCCGG - Intergenic
903025666 1:20428427-20428449 AGAATACTCCCCTTCCAGGCTGG + Intergenic
910687986 1:89937849-89937871 AGAACAGTGCCCTACAAGGCTGG - Intergenic
923228243 1:231959662-231959684 AGAGTAGGGCTCTGCAAGGCAGG - Intronic
1066546574 10:36506372-36506394 AGAATAGTACTTTTCAAGGCAGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1074455065 10:113589226-113589248 AGAAAAAGGGCCTTCAAGGCAGG + Exonic
1090266578 11:125356956-125356978 AGCAGAGGGCCCTGCAAGGCAGG - Intronic
1105956973 13:25292656-25292678 AGAATAGGGCCCTTAGAGGGAGG - Intergenic
1106134013 13:26961034-26961056 AGGAAGGCGCCCTTCCAGGCAGG - Intergenic
1118763610 14:68895507-68895529 AGACTACTTCCCTTCAAGGCTGG + Intronic
1119084361 14:71726424-71726446 AGAAAAACTCCCTTCAGGGCAGG - Intronic
1125361428 15:38868439-38868461 AGGATATTGCCCTTCAAGGCTGG + Intergenic
1131306122 15:91244738-91244760 AGAATACTACCCTTCAAGGGGGG + Intronic
1136407846 16:30059199-30059221 AGAATAGCTCTCTTTCAGGCCGG + Intronic
1137728680 16:50674003-50674025 GGAATAGCGCCGTTCCAGGACGG + Exonic
1145123280 17:20279616-20279638 AGAAAAGTAACCTTCAAGGCTGG - Intronic
1149603786 17:57910823-57910845 AGAAGAGTGCCCTTAAAGTCTGG + Intronic
1151379037 17:73712161-73712183 AGAATCGAGCCCTGGAAGGCTGG - Intergenic
1152564993 17:81096405-81096427 CGAATAGCTCCCTCCAAAGCAGG + Intronic
1152667538 17:81580035-81580057 AGCATAGCGCCCTGGAAGGCAGG - Intronic
1153314706 18:3710494-3710516 AGAAAAGCTCCCGTCAAGGACGG + Intronic
1158442636 18:57490613-57490635 AGAATAGCTACCTGGAAGGCAGG - Exonic
1165748036 19:38242283-38242305 AGAATAATGGCCTCCAAGGCTGG + Intergenic
927851482 2:26502834-26502856 AGAATAACGCCCATCTTGGCAGG - Intronic
928090455 2:28370669-28370691 AGAATGGAGCCCTTCCAGGTGGG - Intergenic
929795540 2:45055838-45055860 AGAACAGGGTCCTTGAAGGCAGG + Intergenic
930058089 2:47267420-47267442 AGAATTGCTCCCTTTAAGGCAGG + Intergenic
932621043 2:73265158-73265180 TACATAGCGCCCTTCAAGCCTGG - Intronic
934603142 2:95673790-95673812 TGAATAGCACCCTTAATGGCAGG - Intergenic
936536528 2:113315999-113316021 TGAATAGCACCCTTAATGGCAGG - Intergenic
937209227 2:120257364-120257386 AGAATAGCGCCCTTCTATCCAGG - Intronic
945108277 2:206338081-206338103 AGAATAACAGCCTTCAACGCAGG + Intergenic
945933785 2:215882760-215882782 AGTATAGGGCCTTTCATGGCTGG - Intergenic
948574211 2:238939419-238939441 AGAGTAGCTCCCGTCGAGGCTGG - Intergenic
1173207067 20:41003441-41003463 AGAAATGTGCCTTTCAAGGCAGG + Intergenic
1174036370 20:47670965-47670987 AGAAGTGTGCCCTCCAAGGCTGG - Intronic
1182862337 22:33570897-33570919 AGAAGAGCACCCTCGAAGGCAGG + Intronic
962166581 3:133055602-133055624 AGAATAGGGCAGTTCAGGGCTGG - Intronic
962350262 3:134651143-134651165 AGGGTAGCGCCCTCCCAGGCGGG - Intronic
969907778 4:10413334-10413356 AGAATACCACCCTTTAAGACAGG - Intergenic
972497735 4:39649380-39649402 AGAAGAGCGCTCTTCATGGCAGG + Intergenic
978413907 4:108455484-108455506 AGAATAGGAACCTGCAAGGCTGG - Intergenic
986651000 5:9963348-9963370 AGAATGGCACCATCCAAGGCTGG + Intergenic
987048605 5:14130296-14130318 AGAATAGTGGCCTACAAGGTTGG - Intergenic
995240996 5:109885206-109885228 AGAATAGCTGGCTTCCAGGCTGG - Intergenic
1015263186 6:131262044-131262066 AGAATAGGGACCGTCAAAGCTGG + Intronic
1019708719 7:2508697-2508719 AGTATATCGTCTTTCAAGGCTGG - Intergenic
1023601968 7:41889278-41889300 AGAACAGGGCCCTTCATGCCTGG + Intergenic
1024525636 7:50346680-50346702 AGAAGAGCTCCTTTCGAGGCAGG - Intronic
1030886014 7:114938462-114938484 AGAATAGTGCCCCTCAAGTCTGG + Intronic
1035078362 7:156196282-156196304 AGAATAGCCCCTTTCCAGGGTGG + Intergenic
1036478407 8:9116207-9116229 AGAAAAGGGGCCTTCAAGTCAGG - Intronic
1037136081 8:15462571-15462593 AAAATAGTGCACTTTAAGGCAGG - Intronic
1044468340 8:92534488-92534510 AGAATTGTTCCCTTGAAGGCTGG - Intergenic
1057438698 9:95065590-95065612 GGAACAGAGCCCTACAAGGCAGG + Intronic
1058379085 9:104358984-104359006 AGAATAGAACACTTCAAGGAGGG + Intergenic
1061883739 9:133580557-133580579 TGAATGGCGCCCTTCCAGCCTGG + Intronic
1185922353 X:4107777-4107799 AGAATAATGCCCTTCAAAGATGG + Intergenic
1195037351 X:100982083-100982105 AGACTAGCGCCTTTCAAACCTGG + Intronic
1197154317 X:123253461-123253483 AGAATAGCGCCCTTCAAGGCTGG - Exonic