ID: 1197155077

View in Genome Browser
Species Human (GRCh38)
Location X:123261828-123261850
Sequence ACAGCTAATGCATTGTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197155077_1197155085 23 Left 1197155077 X:123261828-123261850 CCCCCCTACAATGCATTAGCTGT 0: 1
1: 0
2: 1
3: 13
4: 222
Right 1197155085 X:123261874-123261896 AAAAAAAAGGAGGTGACAGCTGG 0: 1
1: 1
2: 7
3: 85
4: 879
1197155077_1197155083 10 Left 1197155077 X:123261828-123261850 CCCCCCTACAATGCATTAGCTGT 0: 1
1: 0
2: 1
3: 13
4: 222
Right 1197155083 X:123261861-123261883 ATTCACATCTCTGAAAAAAAAGG 0: 1
1: 2
2: 5
3: 48
4: 553
1197155077_1197155087 28 Left 1197155077 X:123261828-123261850 CCCCCCTACAATGCATTAGCTGT 0: 1
1: 0
2: 1
3: 13
4: 222
Right 1197155087 X:123261879-123261901 AAAGGAGGTGACAGCTGGCAGGG 0: 1
1: 0
2: 8
3: 45
4: 384
1197155077_1197155084 13 Left 1197155077 X:123261828-123261850 CCCCCCTACAATGCATTAGCTGT 0: 1
1: 0
2: 1
3: 13
4: 222
Right 1197155084 X:123261864-123261886 CACATCTCTGAAAAAAAAGGAGG 0: 1
1: 0
2: 9
3: 53
4: 527
1197155077_1197155086 27 Left 1197155077 X:123261828-123261850 CCCCCCTACAATGCATTAGCTGT 0: 1
1: 0
2: 1
3: 13
4: 222
Right 1197155086 X:123261878-123261900 AAAAGGAGGTGACAGCTGGCAGG 0: 1
1: 0
2: 3
3: 26
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197155077 Original CRISPR ACAGCTAATGCATTGTAGGG GGG (reversed) Intronic
901179085 1:7327682-7327704 ACAGCTCATGCATGGGAGGAGGG + Intronic
904262711 1:29299223-29299245 ACAGCTGATGCTTTATGGGGAGG - Intronic
904925370 1:34043336-34043358 AAAGCTAATGCAGGGTTGGGGGG - Intronic
906676830 1:47699239-47699261 ACAGCTCATGTATTTTAGGGAGG + Intergenic
906881820 1:49599765-49599787 ACAGCTAAAGCATTGTTTAGAGG - Intronic
908083293 1:60603839-60603861 ACAGCTAAAGCAGTGTTTGGAGG + Intergenic
908609160 1:65836790-65836812 ACAGCTTATCCATGGTAGAGAGG + Intronic
908818811 1:68061168-68061190 ACAGCTAAGGCAGTGTTGAGAGG + Intergenic
909176391 1:72366740-72366762 ACAGCTTATACTTTGGAGGGAGG - Intergenic
909280742 1:73749591-73749613 ACATCTAGTGCATTTCAGGGTGG + Intergenic
910772564 1:90844726-90844748 ACAGCACATGCATAGCAGGGGGG - Intergenic
911892855 1:103394566-103394588 ACAGCTAAGGCAGTGTTTGGGGG - Intergenic
912037999 1:105346652-105346674 ACAGCTAAGGCAGTGTTGAGAGG - Intergenic
912384331 1:109263774-109263796 ACAGGTGATGCATGGAAGGGCGG + Exonic
913265979 1:117044764-117044786 AAATCTAATGCATTGCAGGTGGG + Intergenic
916406571 1:164503459-164503481 ACAGCTAATGCAGTGTTTAGAGG + Intergenic
917555050 1:176076461-176076483 GCAGCTAAAGCAGTGTAGAGAGG + Intronic
917781159 1:178399117-178399139 ACAGATAATTCATTCCAGGGAGG - Intronic
917833821 1:178923650-178923672 ACAGATAATTCTTTGTTGGGGGG - Intergenic
918784058 1:188741846-188741868 ACAGATAATGAATTGTGGAGAGG + Intergenic
918866910 1:189912885-189912907 ACAGCTAATGCAGTGTTAAGAGG - Intergenic
919453303 1:197796391-197796413 ACAGCTAAGGCAGTGTTTGGAGG - Intergenic
921522412 1:216172968-216172990 ACAGCTATTGAATTTCAGGGTGG - Intronic
922201555 1:223406291-223406313 ACAGCTAAAGCAGTGTTGAGAGG + Intergenic
922692188 1:227702614-227702636 ACAGCTAATGCAGTGTTTAGAGG + Intergenic
1065042128 10:21707811-21707833 ACAGCTAAAGCCTTGTGGAGAGG - Intronic
1068255138 10:54499662-54499684 ACAGCTAAAGCATTGTTAAGAGG + Intronic
1074003630 10:109396455-109396477 ACAGCTAAAGCAGTGTAAAGAGG + Intergenic
1074668221 10:115756316-115756338 ACAGCTAAAGCAGTGTGGAGAGG - Intronic
1076444646 10:130504795-130504817 ACAGCTAATGCCATGCAGAGAGG - Intergenic
1078685916 11:13531824-13531846 ACAGCTAAAGCATTGTTTAGAGG - Intergenic
1079735918 11:23997023-23997045 ACAGCTAAAGCAGTGTTAGGAGG + Intergenic
1079937957 11:26641335-26641357 ACGGCTAATGCATTGCAGGATGG + Intronic
1080803832 11:35633824-35633846 TCACCTAATGCATTGTACAGGGG + Intergenic
1084279233 11:68076262-68076284 CAAGCTAATGAATTTTAGGGTGG + Intronic
1085888336 11:80547281-80547303 ACAGCTAAAGCAGTGTAAAGAGG + Intergenic
1087406239 11:97734269-97734291 ACAGCTAAAGCAGTGTTAGGAGG + Intergenic
1087428064 11:98015364-98015386 ACAGCTAAAGCAGTGTATAGAGG + Intergenic
1090419297 11:126562951-126562973 ACAGGTCAGGCATTGTTGGGGGG + Intronic
1090928181 11:131270891-131270913 ACAGCTAAAGCAGTGTTTGGAGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091864339 12:3818246-3818268 ACAGCGAATGAAGTGTAGGGAGG - Intronic
1095130373 12:38535128-38535150 ACAGCTAAAGCATTGTTAAGAGG + Intergenic
1095333929 12:41004094-41004116 ACAGCTAATGCAGTGTTAAGAGG - Intronic
1095356675 12:41282862-41282884 ACAGCTAAAGCAGTGTTTGGAGG + Intronic
1096294484 12:50372275-50372297 ACAACTAATACATAGTATGGTGG + Intronic
1099229676 12:80007628-80007650 TCAGGTAATGCATTGGAGGCGGG - Intergenic
1100356508 12:93836035-93836057 ACAGCACAGGCATTATAGGGTGG - Intronic
1100483057 12:94998000-94998022 ACAGCTAATTCTTTGTTGTGAGG - Intronic
1102345277 12:112156346-112156368 ACAGCTAAAGCAGTGTTGAGAGG - Intergenic
1104677524 12:130723230-130723252 ACAGCTAATGCAGTGTTAAGAGG + Intergenic
1105396434 13:20040755-20040777 ACAGCTAAGGCAGTGTTGAGAGG - Intronic
1107395331 13:40009888-40009910 ACAGCTAAAGCAGTGTTCGGAGG - Intergenic
1107648450 13:42519267-42519289 ACAGCTAAAGCAGTGTATAGAGG + Intergenic
1108428996 13:50335058-50335080 ACAGCTAATGGCTTGAAGCGTGG - Intronic
1108887425 13:55204708-55204730 ACAGCTAAGGCAGTGTCGAGTGG + Intergenic
1109986358 13:69991143-69991165 ACAGCTAAGGCATTGTGAAGAGG + Intronic
1110129008 13:71983220-71983242 ACAGCTAAAGCAGTGTAAAGAGG - Intergenic
1110536028 13:76651828-76651850 ACAGCTAAGGCAGTGTTAGGGGG - Intergenic
1114133254 14:19817840-19817862 ACAGCTAATGCAGTGTTTAGAGG - Intronic
1114133499 14:19820437-19820459 ACAGCTAATGCAGTGTTTAGAGG - Intronic
1114921050 14:27329327-27329349 ACAGCTAATGTATTGGAGCCAGG - Intergenic
1114933382 14:27504086-27504108 ACAGCTAAGGCATTGTTAAGTGG - Intergenic
1116073529 14:40081074-40081096 ACAGCTAATGCAGTGTTAAGAGG - Intergenic
1118048481 14:61999702-61999724 ACAGCTAAAGCATTGCTGAGAGG - Intronic
1120630813 14:86887729-86887751 ACAGCTAAAGCAGTGTTGAGAGG - Intergenic
1120656577 14:87197449-87197471 ACATAAAATGCATTGGAGGGAGG - Intergenic
1121684383 14:95823015-95823037 ACAGCTAAAGCAGTGTTGAGAGG + Intergenic
1124129610 15:26972049-26972071 AGAGCTAATGCATTGGAGGCAGG + Intronic
1126265028 15:46743996-46744018 ACAGCTAAAGCAGTGTTGAGAGG + Intergenic
1127003865 15:54543286-54543308 ACAGCTAAAGCAGTGTTGAGAGG + Intronic
1128968288 15:72083657-72083679 ACAGCTAATGCAGTGTAAAGAGG - Intronic
1129158497 15:73733415-73733437 ACTGCAAATGCATTGCAGGAGGG + Intergenic
1129693746 15:77728822-77728844 ACAGCTCATGGACTGTAGCGAGG + Intronic
1130873740 15:87994075-87994097 ACAGCTGAGGGATTGTAGTGAGG + Intronic
1131214579 15:90526637-90526659 TCAGCTTGTGCAATGTAGGGAGG - Intergenic
1133163659 16:3930618-3930640 AAAGCTAATGCAGTGTTTGGGGG + Intergenic
1136124903 16:28171763-28171785 TCAGATCATGCAGTGTAGGGAGG + Intronic
1138399268 16:56732155-56732177 ACAACTAAAGCAATGAAGGGAGG - Intronic
1138517483 16:57544305-57544327 ACAAATAATGAATTGCAGGGTGG + Intronic
1138923924 16:61567644-61567666 GTAGATAATGCATTGTAAGGTGG - Intergenic
1140566454 16:76048483-76048505 ACAGCTAAAGCAGTGTAAAGAGG - Intergenic
1140939147 16:79704924-79704946 CCAGATAATGCTTTGTAGTGGGG - Intergenic
1141911782 16:87065101-87065123 ACAGAAAATGAATTGAAGGGAGG + Intergenic
1150190192 17:63230434-63230456 ACAGCTAAAGCAGTGTTTGGAGG - Intronic
1153142849 18:1994817-1994839 ACACCTAATTCAGTGTAGTGTGG - Intergenic
1158311995 18:56168931-56168953 ACAGCTAATGTGTAATAGGGAGG - Intergenic
1159654540 18:71016338-71016360 ACAGCTAAAGCAGTATTGGGAGG - Intergenic
1161312577 19:3603163-3603185 GCAGCTAACGCATTCCAGGGCGG + Intronic
926071433 2:9896405-9896427 AAAGCTAAGGCATGGAAGGGGGG - Intronic
927076521 2:19583595-19583617 ACAGCTAAAGCAGTGTTTGGAGG + Intergenic
928003835 2:27545390-27545412 ACACATAATGCATTGTTGGTGGG + Intronic
929945699 2:46370176-46370198 ACAGCTGAGGCAGTGGAGGGTGG + Intronic
931035568 2:58239347-58239369 TCAGCTAATGCATTTTTGGCAGG - Intronic
936065220 2:109326218-109326240 ACAGCTGATTCCTTGTTGGGTGG - Intronic
938171641 2:129082713-129082735 ACAGCAAATCCATTTTAGGGAGG - Intergenic
939391419 2:141573433-141573455 ACAGCTAAAGCAGTGTTAGGAGG + Intronic
939395907 2:141629365-141629387 ACAACTAATTTAGTGTAGGGGGG - Intronic
943095151 2:183419429-183419451 ACAGCTAAAGCACTGTTGAGAGG + Intergenic
943152823 2:184135975-184135997 ACAGCTAAAGCAGTGTTAGGAGG - Intergenic
943352764 2:186814839-186814861 ACAGCTAAAGCAGTGTTAGGAGG + Intergenic
946542949 2:220705628-220705650 ACAGCTAATGGATATTAGAGTGG + Intergenic
1169623277 20:7532334-7532356 AGAGGTAATGAATTGGAGGGAGG - Intergenic
1174022238 20:47540123-47540145 ACTCCTAAGGCAATGTAGGGTGG - Intronic
1174076292 20:47939739-47939761 CCAGATACTGCATTGAAGGGGGG - Intergenic
1177088268 21:16733993-16734015 ACAGCTAATGCAGTGTTTAGAGG + Intergenic
1177764625 21:25442999-25443021 ACAGCTAAGGCAGTGTAAAGAGG + Intergenic
1177878649 21:26666708-26666730 ACAGCTAAAGCAGTGTAAAGAGG - Intergenic
951623741 3:24636263-24636285 ACAGCTAAAGCAGTGTTAGGAGG + Intergenic
953817070 3:46167510-46167532 ACAGCTAAGGCATTGTTAAGAGG - Intronic
957596327 3:82271555-82271577 ACAGCTAAAGCAGTGTTGAGAGG - Intergenic
958503456 3:94944045-94944067 ACAGCTAAAGCATTGTTAAGAGG - Intergenic
958515575 3:95110962-95110984 ACAGCTAATGCATTGTTAAGAGG - Intergenic
959713508 3:109408337-109408359 ACAGCTAATGCAGTGTTTAGAGG - Intergenic
960887730 3:122413634-122413656 ACAGCTTATACACTGTGGGGAGG + Exonic
963479477 3:145852380-145852402 ACATCTATTGTATTGTATGGTGG + Intergenic
966337458 3:178884959-178884981 ACAGCTAATGCAGTGTTAAGAGG + Intergenic
966574169 3:181480616-181480638 ACAGCTAATGCACTGTTTAGAGG + Intergenic
967357597 3:188590063-188590085 ACAGCTCATTTATTCTAGGGTGG + Intronic
968696256 4:2030139-2030161 ACAGCTAAAGCAATGTTAGGAGG - Intronic
969171691 4:5369028-5369050 ACAGCTAATGCAAGGGAGGCAGG - Intronic
971136478 4:23873940-23873962 AAAGCTAGTGCTTTGGAGGGAGG + Intronic
975096926 4:70467248-70467270 ACAGCTAAAGCAGTGTTTGGAGG + Intronic
975338461 4:73208753-73208775 ACAGCTAATGCAGTGCATAGAGG + Intronic
975479606 4:74862811-74862833 ACAGCTAATGCAATGTTTAGAGG + Intergenic
975759161 4:77601090-77601112 AAAGCTATTACCTTGTAGGGTGG - Intronic
976015296 4:80545189-80545211 ACAGCTAATGCAGTGTTAAGAGG + Intronic
977409448 4:96642714-96642736 ACAGTCAACCCATTGTAGGGAGG + Intergenic
978594736 4:110365013-110365035 ACAGCTATGGCTTTGTAGAGAGG + Intergenic
979421673 4:120512099-120512121 ACAGCTAAAGCAGTGTTTGGAGG + Intergenic
979705561 4:123716042-123716064 ACAGCTAAAGCAGTGTTTGGAGG + Intergenic
980184927 4:129449052-129449074 ACAGCTAAAGCAGTGTTAGGAGG + Intergenic
980261683 4:130457543-130457565 ACAGCTAAGGCATTGTTTAGAGG - Intergenic
980969845 4:139557481-139557503 ACAGCTACTGCATGGAGGGGAGG + Intronic
981840320 4:149103995-149104017 ACAGCCAATGCCTGGTAGTGGGG + Intergenic
982848527 4:160280568-160280590 ACAGCTAAAGCAGTGTTGAGAGG + Intergenic
984216083 4:176913991-176914013 ACAGCTAAAGCAGTGTAAGAGGG + Intergenic
985186344 4:187320351-187320373 ACAGCTAAAGCAGTGTTGAGAGG + Intergenic
987915090 5:24202390-24202412 ACAGCTAAGGCAGTGTAAAGAGG + Intergenic
989611574 5:43298571-43298593 ACAACTAATGCATGCTATGGAGG - Exonic
990065098 5:51702412-51702434 ACAGCTAATGCAGTGTTAAGAGG + Intergenic
990619835 5:57547830-57547852 ACAGCTAAAGCATTGTTAAGAGG - Intergenic
990705458 5:58523971-58523993 ACAGCTTATGCATTATAGGCAGG - Intergenic
993146362 5:84098748-84098770 ACAGCTAATGCAGTGTTAAGAGG + Intronic
993242851 5:85413489-85413511 ACAGCTAATGCAGTGTTAAGAGG - Intergenic
995003294 5:107160768-107160790 ACAGCTAAAGCAGTGTTTGGAGG + Intergenic
995666019 5:114543622-114543644 ACAGCTAAGGCAATGTTGAGAGG + Intergenic
995960320 5:117830947-117830969 ACAGCTAAGGCAATGTTGAGAGG - Intergenic
996400891 5:123061305-123061327 ACTGGTAATGAATTGTAGGCTGG - Intergenic
997853322 5:137352051-137352073 ACAGCCAATATATTGTAGAGAGG - Intronic
999597203 5:153217849-153217871 ACAGCTAAAGCAGTGTTGAGAGG + Intergenic
1000567798 5:162872117-162872139 AGAACTCATGCATTGTTGGGAGG - Intergenic
1000782443 5:165499007-165499029 ACAGCAAATGCATGGAGGGGAGG + Intergenic
1001372341 5:171218042-171218064 ACAGCTAAAGCAGTGTTAGGTGG - Intronic
1003420687 6:5955640-5955662 ACAAATAATGCATTGTAGGGTGG - Intergenic
1005703793 6:28430608-28430630 TCTGCTAATTCATTGTAGAGGGG - Intergenic
1009037265 6:58132830-58132852 ACAGCTAAAGCAGTGTTAGGAGG + Intergenic
1009213062 6:60886446-60886468 ACAGCTAAAGCAGTGTTAGGAGG + Intergenic
1009336351 6:62495016-62495038 ACAGCTAATGCAGTGTTTAGAGG + Intergenic
1010672839 6:78707277-78707299 AAAGGTAAGGCATTGTAGTGAGG - Intergenic
1011006228 6:82648329-82648351 ACAGCTAAAGCATTGTTTAGAGG + Intergenic
1011120380 6:83945410-83945432 ACAGCTAAAGCAGTGTATAGAGG + Intronic
1011513213 6:88124547-88124569 ACAGCCAATGGATTGTAGCTTGG + Intergenic
1011922614 6:92599584-92599606 ACAGCTAAAGCAGTGTAAGAAGG + Intergenic
1013896928 6:115100338-115100360 ACAGCTAAAGCAGTGTTAGGAGG - Intergenic
1015481161 6:133711516-133711538 ATAGTTAATGCATTGTATAGTGG - Intergenic
1017773659 6:157663121-157663143 ACAGCAAAGGCAGTGTAGGGAGG - Intronic
1021557024 7:21930304-21930326 ACAGCTAAAGCAGTGTTGAGAGG + Intronic
1024503155 7:50135192-50135214 ACATCTAATCCAGTGTTGGGAGG - Intronic
1024878800 7:54060670-54060692 AAAGCAGATGCAATGTAGGGTGG + Intergenic
1033095651 7:138428361-138428383 ACAGCTAATGGCTTCTAGAGAGG + Intergenic
1033828045 7:145216296-145216318 ACAGCTAAAGCAGTGTTTGGAGG - Intergenic
1033862173 7:145641890-145641912 ACAGCTAATGCAGTGTTACGAGG - Intergenic
1033996424 7:147355280-147355302 ACAGCTAAAGCACTGTTGAGAGG + Intronic
1035190641 7:157164967-157164989 ACAGATAATTCTTTGTTGGGGGG + Intronic
1035632159 8:1116288-1116310 ACAGCTGGTGCTTTGGAGGGTGG - Intergenic
1038456852 8:27678035-27678057 ACCGCTAAAGCAGTGTATGGAGG + Intergenic
1039293562 8:36125095-36125117 ACAGCTAATGCAGTGTTAAGAGG - Intergenic
1042489792 8:69384088-69384110 ACAGCTAATGCAGTGTTAAGAGG + Intergenic
1042693601 8:71531016-71531038 TCAGCTCATGCATTGGGGGGTGG - Intronic
1042773916 8:72408147-72408169 ACAGCTAATGCAGTGTTAAGAGG + Intergenic
1043396864 8:79846016-79846038 ACAGCTAATGCAGTGTTAAGAGG + Intergenic
1044405522 8:91821477-91821499 ACAGCTAAAGCAATGTTGAGAGG + Intergenic
1044508296 8:93046679-93046701 ACAGCTAATGCAGTGTTATGGGG - Intergenic
1044610373 8:94086059-94086081 ACAGCTAAAGCAGTGTTGGGAGG - Intergenic
1044703979 8:94990657-94990679 ACAGCTACTGCATTCAAGGCTGG + Intronic
1046895427 8:119466503-119466525 ACAGCTAAGGCAGTGTTGAGAGG + Intergenic
1048048423 8:130794706-130794728 ACAGCACATGAATTTTAGGGAGG + Intronic
1049313776 8:141948005-141948027 CCAGCTCAGGCATGGTAGGGTGG + Intergenic
1050476533 9:6046511-6046533 AGAGCTAATGCAGTGAACGGTGG - Intergenic
1051695528 9:19764454-19764476 ACAGCTAATGCAGTGTTTAGAGG - Intronic
1051914170 9:22187929-22187951 ACAGCTAAGGCAATGTAAGAGGG + Intergenic
1052052429 9:23863760-23863782 ACAGCTAATGCAGTGTTTAGAGG - Intergenic
1052619016 9:30881307-30881329 ACAGCTAAAGCAGTGTAAAGAGG - Intergenic
1053691348 9:40588890-40588912 ACAGCCAAGGCAGGGTAGGGCGG - Intergenic
1054273454 9:63048595-63048617 ACAGCCAAGGCAGGGTAGGGCGG + Intergenic
1054302608 9:63389861-63389883 ACAGCCAAGGCAGGGTAGGGCGG - Intergenic
1054401380 9:64716361-64716383 ACAGCCAAGGCAGGGTAGGGCGG - Intergenic
1054434988 9:65200681-65200703 ACAGCCAAGGCAGGGTAGGGCGG - Intergenic
1054495401 9:65821000-65821022 ACAGCCAAGGCAGGGTAGGGCGG + Intergenic
1055168560 9:73226403-73226425 ACAGCTAAGGCAGTGTTAGGAGG + Intergenic
1056388063 9:86115954-86115976 CCAGCTAATGTTTTGTAGGGGGG - Intergenic
1056907162 9:90662966-90662988 ACAGCTAAGGCAGTGTTAGGAGG - Intergenic
1057062135 9:92014451-92014473 TCAGCTAATGCAATGTTGAGAGG + Intergenic
1057712067 9:97454675-97454697 ACAGCTAATGCAGTGTTAAGAGG + Intronic
1060099664 9:120828380-120828402 ACAGCTAATAAATAGTAGAGAGG + Intronic
1060907111 9:127316484-127316506 ACAGGGAATGCAGTGTAGGCTGG + Intronic
1061054695 9:128216082-128216104 ACAGATAATGCAATGCAGCGTGG - Intronic
1186200602 X:7151897-7151919 CCAGCTACTTCATTGTGGGGAGG + Intergenic
1186369805 X:8935311-8935333 ACAGCTAATGCAGTGTTGAGAGG - Intergenic
1187607558 X:20902915-20902937 ACAGCTAAAGCAATGTACAGAGG - Intergenic
1188313174 X:28642647-28642669 ACAGCTAAAGCATTGTTTAGAGG + Intronic
1188354379 X:29173176-29173198 AGTGCTAATGGATTGTAGGTAGG + Intronic
1188664908 X:32806932-32806954 ACAGCTAAAGCAGTGTTGAGAGG + Intronic
1189147420 X:38669403-38669425 ACAGCTAATGTATGGAAGGCTGG + Intronic
1190989864 X:55536083-55536105 ACAGCTATTGCAATGTATGCTGG + Intergenic
1191039231 X:56061317-56061339 ACAGCTAAAGCAGTGTTTGGAGG - Intergenic
1191176927 X:57514072-57514094 ACAGCTAATGCAGTGTCAGAAGG - Intergenic
1191785285 X:64910586-64910608 ACAGCTAAAGCATTGTTTAGAGG + Intergenic
1191800183 X:65070585-65070607 ACAGCTAAGGCATTGTTAAGAGG - Intergenic
1191973241 X:66840965-66840987 ACAGCTAAAGCAGTGTAATGAGG + Intergenic
1192702367 X:73488636-73488658 ACAGCTAATGGATGCTAGGCTGG - Intergenic
1192714269 X:73622839-73622861 ACAGCTAAAGCAGTGTTTGGAGG - Intronic
1192732216 X:73812048-73812070 ACAGTTAGTGCATTGTAGATAGG + Intergenic
1193075460 X:77350480-77350502 ACAGCTAATGCAGTGTTTAGAGG + Intergenic
1193267135 X:79485064-79485086 ACAGCTAAAGCAGTGTATAGAGG + Intergenic
1193528364 X:82621564-82621586 ACAGCTAATGCAGTGTTAAGTGG + Intergenic
1194238211 X:91410817-91410839 ACAGCTAATGCAGTGTTAAGAGG + Intergenic
1194789494 X:98128813-98128835 ACAGCTAAAGCAGTGTTGAGAGG - Intergenic
1194948324 X:100094574-100094596 ACAGCTAAGGCAGTGTTAGGAGG + Intergenic
1195825302 X:108993205-108993227 ACAGCTAATGCAGTGTTTAGAGG + Intergenic
1196559475 X:117127930-117127952 ACAGCTAAAGCATTGTTAAGGGG + Intergenic
1197155077 X:123261828-123261850 ACAGCTAATGCATTGTAGGGGGG - Intronic
1201371200 Y:13266660-13266682 ACAGCTAAAGCGTTGTATAGAGG - Intronic
1201511777 Y:14771902-14771924 ACAACTAAAGCATTGTATAGAGG + Intronic
1201575753 Y:15459839-15459861 CCAGCTACTTCATTGTGGGGAGG + Intergenic
1201906716 Y:19093001-19093023 ACAGCTAATCCATATTAGGGAGG - Intergenic