ID: 1197155833

View in Genome Browser
Species Human (GRCh38)
Location X:123269318-123269340
Sequence GTATGGGTTACATCCATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197155828_1197155833 -2 Left 1197155828 X:123269297-123269319 CCCCTAACTTATAGAATTGTTGT 0: 1
1: 0
2: 1
3: 14
4: 231
Right 1197155833 X:123269318-123269340 GTATGGGTTACATCCATGAAAGG 0: 1
1: 0
2: 1
3: 3
4: 90
1197155826_1197155833 27 Left 1197155826 X:123269268-123269290 CCTCACCAATAAAGTGAACATAA 0: 1
1: 0
2: 2
3: 69
4: 592
Right 1197155833 X:123269318-123269340 GTATGGGTTACATCCATGAAAGG 0: 1
1: 0
2: 1
3: 3
4: 90
1197155829_1197155833 -3 Left 1197155829 X:123269298-123269320 CCCTAACTTATAGAATTGTTGTA 0: 1
1: 0
2: 4
3: 14
4: 286
Right 1197155833 X:123269318-123269340 GTATGGGTTACATCCATGAAAGG 0: 1
1: 0
2: 1
3: 3
4: 90
1197155830_1197155833 -4 Left 1197155830 X:123269299-123269321 CCTAACTTATAGAATTGTTGTAT 0: 1
1: 0
2: 5
3: 45
4: 430
Right 1197155833 X:123269318-123269340 GTATGGGTTACATCCATGAAAGG 0: 1
1: 0
2: 1
3: 3
4: 90
1197155827_1197155833 22 Left 1197155827 X:123269273-123269295 CCAATAAAGTGAACATAATAATT 0: 1
1: 0
2: 5
3: 75
4: 640
Right 1197155833 X:123269318-123269340 GTATGGGTTACATCCATGAAAGG 0: 1
1: 0
2: 1
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197155833 Original CRISPR GTATGGGTTACATCCATGAA AGG Intronic
903085346 1:20852368-20852390 GTATGAGTTACATAAATGAAAGG + Intronic
904619584 1:31767178-31767200 GCAAGGGTTACGTCCCTGAAGGG + Intergenic
910062055 1:83105652-83105674 GTAGGGGTTAGATACAGGAAAGG - Intergenic
911696086 1:100891896-100891918 GTTTGGCTTACATTCAGGAATGG + Intronic
912878389 1:113385900-113385922 GTATGGGTCACTTCCAAAAATGG + Intergenic
914947616 1:152080489-152080511 GCATGGGTTTCTTCCTTGAAGGG + Intergenic
915081929 1:153358501-153358523 GTATGGGCTACAGCAATCAAGGG + Intronic
916959046 1:169871105-169871127 GTTTGGGTGACATACAAGAAAGG + Intronic
918117337 1:181508604-181508626 GTCTGGGTTACAGCCATGATGGG + Intronic
919136701 1:193518283-193518305 GTATTTGTTACATGCAAGAAAGG - Intergenic
919366351 1:196666148-196666170 GTATAGGTCACATCCATGCCCGG + Intronic
921362471 1:214342715-214342737 GAATGGGTTATGTACATGAATGG - Intergenic
921362473 1:214342732-214342754 GAATGGGTTATGTACATGAATGG - Intergenic
922866607 1:228866061-228866083 GTAGGGGTGACATCCCTGAGTGG + Intergenic
923257667 1:232235110-232235132 GGATGGGTGACAGCCAGGAAAGG - Intergenic
1082615279 11:55352710-55352732 ATTTGGGTTACATGAATGAAAGG + Intergenic
1086273679 11:85097959-85097981 GTTTGGGCAACATACATGAAAGG + Intronic
1088732941 11:112699378-112699400 GTATGGTTTACTACCATGCAGGG + Intergenic
1091135662 11:133186688-133186710 GTTTGGGTTACATCCACGAATGG + Intronic
1092484509 12:8890892-8890914 GTATAGGTTACATCCGAGGAGGG - Intergenic
1098452442 12:70635063-70635085 ATCTGGGTTATATCCATTAATGG + Intronic
1099893243 12:88614627-88614649 GTAGGGCTTAAATCTATGAAGGG + Intergenic
1099909399 12:88811282-88811304 GTATAGGTTACATGCCTGCAAGG + Intergenic
1101267452 12:103104223-103104245 GTATGCGTTTTATCCAGGAATGG - Intergenic
1101333085 12:103772775-103772797 GTAAGGGTTACAGGCAGGAAGGG + Exonic
1101899477 12:108780603-108780625 CTTTGGGTTCCAGCCATGAATGG - Intergenic
1102486160 12:113258909-113258931 GTAAGGCTTACAACCATGCAAGG - Intronic
1103307886 12:119980655-119980677 AAATGGGTTACATGCATGATGGG - Intergenic
1111607547 13:90560798-90560820 GTATGGCCTACACCCACGAATGG - Intergenic
1119742091 14:77020473-77020495 GTATTGGTTGCATCCCAGAAGGG + Intergenic
1126935785 15:53706033-53706055 TTATGGGCTACATGAATGAAAGG - Exonic
1137527347 16:49247852-49247874 GTATTAGTTACATGCATGCATGG + Intergenic
1147356774 17:39904673-39904695 GAATGGGATACATCAAAGAATGG + Exonic
1154279826 18:12992633-12992655 GAATGTGTTATGTCCATGAATGG + Intronic
1158809737 18:61018588-61018610 GTGTGGGTCACAGCCATGAGAGG - Intergenic
1167641527 19:50685232-50685254 GTAGGGGCAACATCCAGGAAGGG + Intronic
926789961 2:16560445-16560467 GTAGGGGCTACAGCCATAAATGG + Intronic
927067425 2:19487471-19487493 GTATGGGTTTCAGACAGGAAAGG - Intergenic
928671711 2:33609815-33609837 GTTTGGCCTACATCCAGGAATGG - Intergenic
928786751 2:34896462-34896484 GTATTTGTTCCAACCATGAATGG - Intergenic
931552361 2:63461054-63461076 GAATGTGTTACTTCCATGTAAGG + Intronic
933122275 2:78554273-78554295 GTATGGGAGACATGCAGGAATGG + Intergenic
933151362 2:78919134-78919156 GTTTGGGTGACCTCCAGGAATGG + Intergenic
935883577 2:107591718-107591740 GTAAGGGTTTCATGCAAGAAAGG + Intergenic
939767182 2:146265537-146265559 GTATGGGTCACATACAGAAATGG - Intergenic
939867483 2:147488974-147488996 GTATCTGTTAAATCAATGAATGG + Intergenic
941096923 2:161247670-161247692 GTATAGGTTACAGCCAAGACTGG - Intergenic
944786060 2:203071539-203071561 GTATGTGTTAAGTACATGAATGG - Intronic
945045220 2:205775935-205775957 GTATGGGATTCAACCAAGAATGG - Intronic
945218706 2:207462971-207462993 GTATGGATAACATACATAAAGGG - Intergenic
946817707 2:223595938-223595960 GTATGGGTCACTTCCAAAAAAGG - Intergenic
947394573 2:229674244-229674266 GTCTGGGTCACATCCAGAAATGG - Intronic
948830433 2:240595966-240595988 ATGTGGGCCACATCCATGAAGGG - Intronic
1169018042 20:2307593-2307615 GAATGGGATAAATCCAGGAAAGG - Intronic
1175301256 20:57944310-57944332 GTATAGGATACCTGCATGAATGG + Intergenic
1178181837 21:30170513-30170535 ATATGGGCTACATCTATGAATGG - Intergenic
1179472101 21:41617978-41618000 GTGTGTGTTACATACATGATTGG - Intergenic
955066196 3:55535591-55535613 GTAAGGCTCACACCCATGAATGG + Intronic
955943877 3:64172453-64172475 GTAAGTGTTACATCCATTATTGG - Intronic
956613866 3:71151940-71151962 GTATGGGCAGGATCCATGAATGG + Intronic
966545930 3:181148303-181148325 TTTTGGGTTATATGCATGAATGG + Intergenic
969082982 4:4634162-4634184 GTGTGGGTTAAATGCAGGAATGG + Intergenic
971235671 4:24839858-24839880 GGATGGGTTTCATATATGAATGG + Intronic
972706840 4:41553212-41553234 TTCGGGGTTACAACCATGAATGG + Intronic
982085146 4:151827849-151827871 GTATGTGTTAGATGGATGAATGG - Intergenic
982975643 4:162056241-162056263 AAATGGGTTACATATATGAATGG + Intronic
991381922 5:66037303-66037325 GTATGGGTTATATGCCTCAAAGG + Intronic
994214299 5:97120230-97120252 CTATTGGTTACATACAAGAATGG + Intronic
1005145653 6:22687065-22687087 GAATGGGTGTCACCCATGAATGG - Intergenic
1008827313 6:55712494-55712516 AAATGGGTAAAATCCATGAAGGG - Intergenic
1012004950 6:93702121-93702143 GGATGGGCTACATCCACTAATGG - Intergenic
1012157361 6:95836351-95836373 GTATGGGTTACATCACTGCTAGG - Intergenic
1012841064 6:104329630-104329652 ATATGGGTTAAATCCATACACGG + Intergenic
1013690668 6:112638477-112638499 GAATGGGTGACATTCATGTAGGG - Intergenic
1014855913 6:126401018-126401040 GTCTGGGTTACATCCAAGTCTGG + Intergenic
1015004982 6:128268985-128269007 GTATGGTTAACATTCCTGAAGGG + Intronic
1019907297 7:4074481-4074503 GTGAGGGTTACATGAATGAATGG + Intronic
1024975274 7:55108400-55108422 GTGTGGGTTATCTCCATAAATGG + Intronic
1027522313 7:79224598-79224620 CTCAGGGTTACATCCATCAATGG + Intronic
1030095606 7:105896436-105896458 GTAGTGGTTACATCTAGGAAGGG + Intronic
1036111573 8:5908709-5908731 GTATGAGTTAGAGCCAGGAATGG + Intergenic
1037099465 8:15025644-15025666 GTAGGACTTACATCCAAGAAAGG + Intronic
1040343156 8:46455492-46455514 CTGTGAGCTACATCCATGAAGGG + Intergenic
1042716271 8:71776328-71776350 GTATGGTTTCCATCCTTAAATGG + Intergenic
1044086184 8:87944701-87944723 ATATGGGTAACATTCTTGAAAGG + Intergenic
1045149887 8:99393098-99393120 ATATGGTTTACATGCATGTAAGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1055008784 9:71539963-71539985 GTGTGGGTCACAGGCATGAACGG + Intergenic
1188765235 X:34082362-34082384 GTATGGGTCACACTCAAGAATGG + Intergenic
1194479549 X:94403367-94403389 CTAGGGATGACATCCATGAAGGG + Intergenic
1194710055 X:97225348-97225370 GTATGGGTTATATGCAAGGAAGG + Intronic
1195726058 X:107917881-107917903 CTAAGGGTTACATAAATGAATGG - Intronic
1196596416 X:117550926-117550948 GTCTGACTTACAGCCATGAAAGG - Intergenic
1197155833 X:123269318-123269340 GTATGGGTTACATCCATGAAAGG + Intronic
1199462071 X:148095895-148095917 GTATGTGTTAAATGCATGGATGG - Intergenic