ID: 1197158000

View in Genome Browser
Species Human (GRCh38)
Location X:123291225-123291247
Sequence CCTTGAAGGTGCTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197157991_1197158000 28 Left 1197157991 X:123291174-123291196 CCTGGACAAAGCACCCTACTGAG No data
Right 1197158000 X:123291225-123291247 CCTTGAAGGTGCTGGAAGCCTGG No data
1197157994_1197158000 14 Left 1197157994 X:123291188-123291210 CCTACTGAGGAGAACTGAATAGC No data
Right 1197158000 X:123291225-123291247 CCTTGAAGGTGCTGGAAGCCTGG No data
1197157993_1197158000 15 Left 1197157993 X:123291187-123291209 CCCTACTGAGGAGAACTGAATAG No data
Right 1197158000 X:123291225-123291247 CCTTGAAGGTGCTGGAAGCCTGG No data
1197157996_1197158000 -8 Left 1197157996 X:123291210-123291232 CCAGGAACTGAAAAGCCTTGAAG No data
Right 1197158000 X:123291225-123291247 CCTTGAAGGTGCTGGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197158000 Original CRISPR CCTTGAAGGTGCTGGAAGCC TGG Intronic