ID: 1197162706

View in Genome Browser
Species Human (GRCh38)
Location X:123342066-123342088
Sequence GTCTAGGTCTTTAGGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197162706_1197162711 3 Left 1197162706 X:123342066-123342088 CCTTATTTCCTAAAGACCTAGAC 0: 1
1: 0
2: 1
3: 6
4: 146
Right 1197162711 X:123342092-123342114 TTTTATGTACCACATCTAAAGGG 0: 1
1: 0
2: 1
3: 30
4: 345
1197162706_1197162710 2 Left 1197162706 X:123342066-123342088 CCTTATTTCCTAAAGACCTAGAC 0: 1
1: 0
2: 1
3: 6
4: 146
Right 1197162710 X:123342091-123342113 ATTTTATGTACCACATCTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 180
1197162706_1197162713 13 Left 1197162706 X:123342066-123342088 CCTTATTTCCTAAAGACCTAGAC 0: 1
1: 0
2: 1
3: 6
4: 146
Right 1197162713 X:123342102-123342124 CACATCTAAAGGGATGCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197162706 Original CRISPR GTCTAGGTCTTTAGGAAATA AGG (reversed) Intronic
901749814 1:11399030-11399052 GGCTAGGTCTTTAAGAATTGAGG + Intergenic
904855339 1:33493589-33493611 GTCTGGGGCTTTAGGACACAAGG - Exonic
906457751 1:46011697-46011719 GTCTTGGTCTGGAGGTAATAAGG - Intronic
908172833 1:61524699-61524721 AAATAGGTCTTTAGAAAATAGGG + Intergenic
908476783 1:64496822-64496844 ATCTAGGTTTTGAGGAAATTGGG - Intronic
908803496 1:67905669-67905691 GTCTAGGTCTCTAGCAAGGATGG + Intergenic
909060329 1:70871710-70871732 CTCTAGCTCATTAGGTAATAAGG - Intronic
909432944 1:75610991-75611013 GTCTATGTCTGTAGGAAAATTGG - Intronic
912096818 1:106155160-106155182 GTCTAGACCTTTGGGAAAAAAGG + Intergenic
916644346 1:166768012-166768034 GTCTAGGAGTTTAGTAAATCAGG + Intergenic
917200683 1:172511208-172511230 GTTTAGCTCTGTAGGAAATGGGG - Intergenic
918488562 1:185055106-185055128 GACTAGGGCTTTAGGGAATAGGG + Intronic
920790700 1:209087554-209087576 GTATATGCCTTTAGCAAATATGG - Intergenic
1062845396 10:699401-699423 GTGTAGCTATTTTGGAAATAGGG - Intergenic
1070275697 10:75004513-75004535 GTCTAGGTGATGAGGACATAAGG + Intronic
1071888331 10:89974885-89974907 GTCTAGATCTATAACAAATAGGG - Intergenic
1075309944 10:121405641-121405663 ATCTGGGGCTTTAGGAAATCAGG - Intergenic
1079590150 11:22173728-22173750 GTCTAGGTCATCAAAAAATAAGG + Intergenic
1081542579 11:44046741-44046763 GTCTAGATTTTTAGAAAAAAGGG + Intergenic
1082120719 11:48377284-48377306 GTCTAGATCTCTAGGAAAGCTGG + Intergenic
1084386434 11:68845575-68845597 CTCTAGGTGTTGAGTAAATATGG + Intergenic
1087169414 11:95036267-95036289 TTATAGGTTTTTAGAAAATATGG + Intergenic
1088239663 11:107760141-107760163 GTCTAGGTCTCTAGGAAGGCTGG - Intergenic
1088278221 11:108111500-108111522 GTCTAGATCTTTTTGAGATAGGG + Intergenic
1089900242 11:121974880-121974902 GTCTAGGTCTCTAGCAAAGCTGG - Intergenic
1090757453 11:129804945-129804967 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
1094219043 12:27973974-27973996 GAGAAGGTCTTTAGGAAATGGGG + Intergenic
1096486749 12:51987754-51987776 TACTAGGTCTTTAAAAAATATGG - Intronic
1097385815 12:58949281-58949303 GTCTAGGTCTCTAGCAAAGCTGG + Intergenic
1097559959 12:61190517-61190539 GACTAGGTCTCCAGGAAATCTGG - Intergenic
1098390888 12:69968778-69968800 GTCTGGGTCTTCTGTAAATATGG + Intergenic
1098982533 12:76973106-76973128 GTCTAGGTCTCTAGCAAAGCTGG + Intergenic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103613698 12:122139188-122139210 CTCTAGGTCCTTAAGAAATCAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105274697 13:18908887-18908909 GACTAATTATTTAGGAAATAGGG + Intergenic
1109225649 13:59691417-59691439 ATCTAGGTGTTTAGGAAATATGG + Intronic
1110881701 13:80579254-80579276 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
1110910703 13:80959139-80959161 GTATATATTTTTAGGAAATAAGG - Intergenic
1112770499 13:102789900-102789922 GTCTGGGTGTTTAAAAAATACGG - Intronic
1115997136 14:39205829-39205851 GTCTAGGTCTCTAGCAAGTTTGG - Intergenic
1116219100 14:42058949-42058971 GTAAAGGTATTTAGAAAATAAGG - Intergenic
1116955114 14:50915467-50915489 GTCCACATCTTTAGGAAACAAGG + Exonic
1118031013 14:61817831-61817853 GTCAAAGGCTTTAGGAAAAAAGG + Intergenic
1120164727 14:81184959-81184981 GTCTAGGAATTAAGAAAATAAGG + Intronic
1122316624 14:100829149-100829171 GTTTAAGTCTTTAGGTAAGAGGG - Intergenic
1124795958 15:32780073-32780095 GTCATGTTTTTTAGGAAATAAGG - Intronic
1126929138 15:53627375-53627397 GGCTAGGTCTTTATGTTATAAGG - Intronic
1129928589 15:79388240-79388262 GTCTATCTCTTTAGACAATAGGG + Intronic
1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG + Intergenic
1135202997 16:20455249-20455271 GTCTAGGTCTTTAGCAAGGCTGG - Intronic
1135216101 16:20572613-20572635 GTCTAGGTCTTTAGCAAGGCTGG + Intronic
1140833662 16:78774068-78774090 GTCTAGGTCCTTCTGAAAGAAGG + Intronic
1145059951 17:19726516-19726538 GTCTATGTCTTTAAGACATCAGG - Intergenic
1149420733 17:56508706-56508728 GTGTAGGTATATAGGAAAGAGGG - Intronic
1150437879 17:65168116-65168138 GTCTAGGTCATCAGGAATGAGGG + Intronic
1151095671 17:71494963-71494985 GTCTAAGTCTTAAAGAAATTAGG + Intergenic
1156424125 18:36990167-36990189 GTCCAGTTCTTTAAGAAAAATGG + Intronic
1156770351 18:40713623-40713645 TTCTTGGTCTTTATGATATAAGG + Intergenic
1157079116 18:44502615-44502637 TTCTAGGACTATAGGAAATTTGG + Intergenic
1159227643 18:65560532-65560554 GTAGATGTCTTTAGGTAATATGG - Intergenic
1159409756 18:68055930-68055952 TTCTAGGTCTTTGGGAAAATCGG - Intergenic
1164438780 19:28255525-28255547 TTCTGGGTCCTTAGAAAATAGGG + Intergenic
1164719506 19:30422211-30422233 GTTTAGGATTTTAGGAAACAGGG + Intronic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
926515111 2:13833884-13833906 AGCTAGGTCTTGAGGAAAAACGG - Intergenic
931913546 2:66928419-66928441 GTCTAGGTCAGTAGGTTATAGGG - Intergenic
932795188 2:74688647-74688669 GTATAGAATTTTAGGAAATAGGG + Intergenic
935180581 2:100686905-100686927 TTCAATGTCTTTAGAAAATAAGG - Intergenic
935299034 2:101676759-101676781 GTCAGGGTCATTGGGAAATATGG + Intergenic
937535334 2:122879629-122879651 TTCTAAATCTTCAGGAAATATGG - Intergenic
938023362 2:127924225-127924247 TTCTAAGTCTTTATGAAAAATGG + Intergenic
938050851 2:128169469-128169491 GTTTAGTTCTTCAGGAAATGTGG + Intronic
939701556 2:145398799-145398821 GTCTAAGTCTCCAAGAAATAAGG + Intergenic
940431376 2:153593632-153593654 GTGTAGGGGTTTAGGAAAGATGG + Intergenic
941434646 2:165454186-165454208 ATCTTGGTCTCTAGGAAAGATGG - Intergenic
946504793 2:220287429-220287451 TACTAGGAGTTTAGGAAATATGG - Intergenic
946531736 2:220577977-220577999 GGCTAGGTCTTTGGTAAATTGGG - Intergenic
947235658 2:227938203-227938225 GCCTAGGCCATTTGGAAATAAGG + Intergenic
1170118419 20:12886100-12886122 GGGTAGGTCTTTAGAAAAAAGGG + Intergenic
1172560247 20:35881575-35881597 GTCCTTGTCTTTAGGAAATATGG - Intronic
1173619208 20:44423797-44423819 GTTTAGTGCTTTAGGAAATGTGG + Intronic
1176808203 21:13512456-13512478 GACTAATTATTTAGGAAATAGGG - Intergenic
1177351103 21:19943066-19943088 GTCTAGTACTTTAGAGAATACGG + Intergenic
1177847472 21:26307133-26307155 GTCTAGGTCTCTAGCAAAGCTGG - Intergenic
1178014849 21:28332627-28332649 GTTTAAGTATTTAGGAGATATGG - Intergenic
1179386159 21:40944294-40944316 GTCCAGGCCTTTAGAAACTACGG + Intergenic
1180250847 21:46586669-46586691 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
1180589782 22:16927637-16927659 TACTCAGTCTTTAGGAAATAAGG - Intergenic
949146280 3:704051-704073 CTTTAGGTCCTTAGGCAATATGG - Intergenic
952636398 3:35537930-35537952 GTATAAGTATTTAGAAAATATGG + Intergenic
955111262 3:55952548-55952570 TTCCAGTTCCTTAGGAAATAAGG + Intronic
958770810 3:98423077-98423099 GTCTAGGTCTCTAGCAAAGCTGG - Intergenic
958929336 3:100192231-100192253 TTTAAGGTCCTTAGGAAATAAGG + Intronic
962314120 3:134348297-134348319 CTCTAGGTCTTCAGCTAATAGGG - Intergenic
962764746 3:138550974-138550996 GTCTAGGTCTTTAGCAAGGCTGG - Intronic
963213355 3:142718324-142718346 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
964505222 3:157391567-157391589 GTCAGAGTCTTTGGGAAATATGG + Intronic
965321740 3:167260371-167260393 GTCTAGGTCTCTAGGAAGGCCGG + Intronic
968248650 3:197183412-197183434 GTGTAGGTCTTTAGCACAAAAGG - Intronic
970034611 4:11718850-11718872 TTCTAAGTCTTGGGGAAATATGG - Intergenic
973179071 4:47245697-47245719 GTCTAACTCTTTAGGAATAATGG - Intronic
976577366 4:86689704-86689726 GTCCAGGTCTTGGGGAAATCTGG - Intronic
977344480 4:95800055-95800077 GTATAGGTTTATAAGAAATAAGG + Intergenic
977510602 4:97957522-97957544 GTCTAGGTCTTTAGCAAGGCTGG - Intronic
979378791 4:119983505-119983527 TTCTAGGAATTGAGGAAATAGGG - Intergenic
985322144 4:188724931-188724953 TTTTAGGTCTTTTGGAGATAGGG - Intergenic
986903028 5:12460426-12460448 TTCTAGGTCTTTATGGATTAAGG - Intergenic
989988233 5:50728557-50728579 GTGTAGTTCTTTAGGAACTGAGG - Intronic
991613748 5:68474887-68474909 GTGTAGGTCATAAGGAAATGTGG + Intergenic
992752027 5:79870637-79870659 GTCTAGGTCTTCAGGGGAAATGG + Intergenic
995827927 5:116322084-116322106 CACTAGTTCCTTAGGAAATACGG + Intronic
996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG + Intergenic
997640948 5:135448568-135448590 GGCAAGGTCTTTAGGGAATGAGG - Exonic
998547070 5:143038489-143038511 GAATTGGTCTTGAGGAAATAAGG + Intronic
999066421 5:148691498-148691520 GTATATGGCTTTAGGCAATATGG - Intergenic
1003133398 6:3414686-3414708 ATCTTGGCCTTGAGGAAATAAGG - Intronic
1008138894 6:47809088-47809110 TTTTGGGTCTTTAGGAAAAATGG - Intronic
1008810709 6:55494207-55494229 GTTTAGGTCTTCAGGATAAAGGG - Intronic
1010161931 6:72866784-72866806 TTCAAGGTCCTTAGGCAATATGG - Intronic
1011132992 6:84071619-84071641 GTCTAGGTCTCTAGGAAGGCTGG + Intronic
1011394765 6:86894457-86894479 GTCTAGGTCTCTAGCAAAGCTGG - Intergenic
1011784982 6:90833517-90833539 CTCTAAGTCTTTAGGAGATCAGG + Intergenic
1014466789 6:121765506-121765528 GTTCAGGTTTTAAGGAAATAAGG + Intergenic
1015222293 6:130817870-130817892 GTCTAGGTCTTTAGCAAGGCCGG - Intergenic
1016993243 6:149943580-149943602 CTCTAGGTCATTAGGAAGTTAGG - Intronic
1020863855 7:13531240-13531262 GTGTAGGACTTTAGGAAAACAGG + Intergenic
1026297546 7:69068146-69068168 GTCTACCTCTTTAGGAGACATGG + Intergenic
1026638193 7:72102734-72102756 GTGTAGGGCTTGGGGAAATATGG + Intronic
1028150755 7:87368494-87368516 CCCTAGGTCTTGAGGAAATAAGG + Intronic
1028881241 7:95882413-95882435 ATCCAGGACTTTAAGAAATATGG - Intronic
1030820799 7:114088008-114088030 GTCTAGGTCTTTGGGGATTCCGG - Intronic
1037180300 8:15996814-15996836 GTCTAAGTTTTAAGAAAATAAGG - Intergenic
1039895867 8:41716081-41716103 GGCTGGGCCTTTGGGAAATAAGG - Intronic
1042615805 8:70647731-70647753 GTCTAAGGATTTAGGAAATCTGG + Intronic
1047923059 8:129655041-129655063 GTCTAGGTATTTAGTATTTATGG - Intergenic
1048458016 8:134595672-134595694 GTCTTGGCATTGAGGAAATATGG - Intronic
1048516089 8:135113059-135113081 GTCCATGTCTTTGGGAACTATGG + Intergenic
1050100298 9:2111989-2112011 TTCTAAGTCTTCAGGAAATATGG + Intronic
1050336112 9:4591421-4591443 GTCCGGGTCTTTAGGAAACTAGG + Intronic
1050879237 9:10678412-10678434 GTCTCATTCTTCAGGAAATAGGG + Intergenic
1054813260 9:69451519-69451541 GTCTAGGGAATGAGGAAATACGG - Intronic
1055062519 9:72084763-72084785 GTGTATATCTGTAGGAAATAAGG + Intergenic
1055947896 9:81707967-81707989 TTCTAGGTATTGAGGACATAAGG + Intergenic
1057788578 9:98107352-98107374 GTCTAGGGCTATTGCAAATAAGG - Intronic
1062330547 9:136041583-136041605 GTCTAGGGCTGAAGGGAATACGG + Intronic
1185986523 X:4841188-4841210 GTCTATCTCTTTAGGAAGTATGG + Intergenic
1187773462 X:22729379-22729401 GTCTAGGTCTCTAGCAAAGCTGG + Intergenic
1191760389 X:64641652-64641674 GTCTATGTCTCTAGAAAAAATGG + Intergenic
1193817413 X:86120968-86120990 GTCTAGGTCTCTAGCAAAGCTGG + Intergenic
1197162706 X:123342066-123342088 GTCTAGGTCTTTAGGAAATAAGG - Intronic
1197271913 X:124433948-124433970 GTCTTAGAATTTAGGAAATATGG + Intronic
1198235401 X:134732188-134732210 GTCTGGAGCTTTAGGAAATCTGG - Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic