ID: 1197168609

View in Genome Browser
Species Human (GRCh38)
Location X:123406775-123406797
Sequence TTCCAACACCAGTGCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197168607_1197168609 0 Left 1197168607 X:123406752-123406774 CCAGCAGTAAGAAAGAGAAGAAT 0: 1
1: 0
2: 2
3: 32
4: 356
Right 1197168609 X:123406775-123406797 TTCCAACACCAGTGCAGAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197168609 Original CRISPR TTCCAACACCAGTGCAGAGA GGG Intronic
900343781 1:2201214-2201236 TTCCAACACAGGGGCAGCGAGGG - Intronic
900576183 1:3383590-3383612 TTCCAGCACCAGGCCCGAGATGG + Intronic
900985046 1:6068476-6068498 TTGCAACTCCACTGGAGAGATGG - Intronic
903631641 1:24778150-24778172 TTCTTACACCAGAGCAAAGAAGG - Intronic
905863263 1:41363860-41363882 TTCCAAAAGCAGGGTAGAGAGGG - Intronic
907106778 1:51890070-51890092 TTCCAAGGCTAGGGCAGAGAAGG + Intergenic
908601812 1:65747091-65747113 TTGCAAAACCAGTGCTAAGAGGG + Intergenic
909896701 1:81080164-81080186 TTCCAAAACCAAACCAGAGATGG + Intergenic
910682702 1:89883517-89883539 TTCCAATACCAGTGCTGACCAGG - Intronic
912857525 1:113183553-113183575 TGCCAAGACCAGTGTTGAGAAGG - Intergenic
913110425 1:115652634-115652656 TTCCCAAGCCAGTGCAGAGCTGG - Intronic
916752620 1:167737266-167737288 TACAAACATCAGAGCAGAGAGGG + Intronic
916852798 1:168720655-168720677 TTCCAACCCCACTGCAGAGATGG + Intronic
919671072 1:200338628-200338650 TTCAAACTACAGTGCAGAGTTGG - Intergenic
919671598 1:200343334-200343356 TTCCCAAAACAGTGCAGGGAAGG + Intergenic
920703742 1:208236711-208236733 TTCCACCACCAGAGCAGAAGCGG + Intronic
922795173 1:228336211-228336233 TTCCAACCCCTGTGCTGAGATGG - Exonic
922979863 1:229816635-229816657 AACAAACACCATTGCAGAGAAGG + Intergenic
923211354 1:231806959-231806981 TCCCAGCACCATTCCAGAGAAGG - Intronic
923264310 1:232299010-232299032 TTCCAGCAGCAGATCAGAGAGGG - Intergenic
1063699380 10:8369869-8369891 TTTCAACAATAGTTCAGAGATGG + Intergenic
1064352382 10:14588225-14588247 TTCCAGCACAAATGCAGAAAAGG + Intronic
1066041341 10:31551080-31551102 CTCAAACCCCAGGGCAGAGATGG - Intergenic
1069058838 10:63872405-63872427 TTCCAACTCCTGGGCTGAGAGGG - Intergenic
1072306207 10:94109925-94109947 TTTTTAGACCAGTGCAGAGATGG + Intronic
1073022114 10:100453976-100453998 TTTCAACACCTGTGAAAAGAAGG - Intergenic
1073730733 10:106284616-106284638 TTCCAATACCTTTGCAGAGAAGG - Intergenic
1074431619 10:113399646-113399668 CTGCAACTCCAGTGCAGAGGAGG + Intergenic
1076043421 10:127270695-127270717 TTCCAACAAGACTTCAGAGAAGG + Intronic
1076330365 10:129659966-129659988 TTTCATCACCCGTGCAGTGAAGG + Intronic
1077815877 11:5684935-5684957 TTCAGACACCAGTGCAGAAGTGG + Exonic
1078104758 11:8351491-8351513 ATCCATCACCCGTGCAGGGACGG - Intergenic
1079675867 11:23225715-23225737 TATCAACACCAGTGCAAAGAGGG + Intergenic
1079976446 11:27097704-27097726 TGCCAACAGCAGTTCAAAGAGGG + Intronic
1084748357 11:71187924-71187946 TTCCAAGGACAGTGCAGGGAAGG - Intronic
1086583379 11:88424593-88424615 TTTCAACACCATTGCATTGAAGG + Intergenic
1086839527 11:91667578-91667600 CTCCAGCACCTGTGCAGTGAAGG - Intergenic
1088412337 11:109548517-109548539 TTCCAAGGCCAGTGTTGAGAAGG - Intergenic
1089504419 11:118953983-118954005 TTCCACCACCACTGCACAAATGG - Intronic
1089617183 11:119701545-119701567 TACCAACCCCAGAGCAGAGAAGG - Intronic
1090835496 11:130450431-130450453 TTCCAGGCCCAGTACAGAGAGGG - Intronic
1090923017 11:131223808-131223830 TCCCAGCACCAGAGCAGGGATGG + Intergenic
1091595405 12:1875327-1875349 TGCCCACTCCAGTACAGAGAGGG - Exonic
1092161450 12:6317535-6317557 TTCTCACACCACTGCAGGGAAGG - Exonic
1094352225 12:29539900-29539922 TTCCCACACCACTTCACAGATGG + Intronic
1096386367 12:51197636-51197658 TTCCAACACATCAGCAGAGATGG - Intronic
1096745245 12:53722508-53722530 GTCCAACTCCAGAGCAGATAGGG - Intronic
1098140673 12:67447442-67447464 TTCCAGGACAAGAGCAGAGAAGG + Intergenic
1098772145 12:74566144-74566166 TTCCATGACAGGTGCAGAGAAGG - Intergenic
1101569070 12:105936671-105936693 TTCCCAGACCAGTCCTGAGAAGG - Intergenic
1103939651 12:124494876-124494898 TCCCACTACCAGTCCAGAGAGGG + Intronic
1108340405 13:49493988-49494010 TTCCAGAAACAGTGAAGAGATGG - Exonic
1109047923 13:57437556-57437578 TTCCACCACCAGGGTGGAGAGGG + Intergenic
1109653844 13:65364437-65364459 ATGAAACACCAGAGCAGAGATGG - Intergenic
1112206565 13:97329516-97329538 CTCTAAGGCCAGTGCAGAGAAGG - Intronic
1113555243 13:111228843-111228865 TTCAACCACCAGAGCAGACATGG - Intronic
1117445294 14:55798442-55798464 CTCCAACACCAGTGCACACATGG - Intergenic
1117510774 14:56448723-56448745 TTCCACTACAAGTGCAGATATGG + Intergenic
1117647585 14:57867535-57867557 AACCAACACTAGTGCAGTGATGG + Intronic
1117749515 14:58905712-58905734 TAGCAACACCAGTGCTAAGAGGG + Intergenic
1117868406 14:60172879-60172901 CTCCAATAACAGTGCAGGGAAGG + Intergenic
1118390218 14:65289264-65289286 TTGCAACCCCAGTGGAGAAAGGG - Intergenic
1118975996 14:70677118-70677140 TTCCTTCTACAGTGCAGAGAGGG - Intergenic
1122356533 14:101126171-101126193 GACCAACCCCAGGGCAGAGATGG + Intergenic
1123463315 15:20494325-20494347 TGCCAACACCCAAGCAGAGAGGG + Intergenic
1123654744 15:22506086-22506108 TGCCAACACCCAAGCAGAGAGGG - Intergenic
1123888848 15:24755261-24755283 TGCCAGCACCTATGCAGAGAGGG - Intergenic
1124274159 15:28311732-28311754 TGCCAACACCCAAGCAGAGAGGG + Intronic
1124308656 15:28601288-28601310 TGCCAACACCCAAGCAGAGAGGG - Intergenic
1125316696 15:38440382-38440404 TGCCAACAGAAGTGCAGAGCGGG - Intergenic
1127798535 15:62458144-62458166 TGCCCACACCACTGCAGAGGTGG - Intronic
1128439690 15:67694149-67694171 TTCAAAGACCAGTGCAGACTTGG + Intronic
1128566892 15:68706652-68706674 TTCCTACTCAAGTGCAGACAAGG + Intronic
1132298218 15:100760106-100760128 TGACATCAGCAGTGCAGAGACGG + Intergenic
1132770989 16:1563182-1563204 CTCCACCACCAGAGCAGGGAGGG - Intronic
1132796087 16:1723737-1723759 TTCCTACAGCAGCCCAGAGAGGG - Intronic
1134355898 16:13482070-13482092 TTCCAGCACCAGGGCAGGGATGG - Intergenic
1137526951 16:49244776-49244798 TTCCAACACCCATGCTGAAATGG + Intergenic
1137607971 16:49799479-49799501 TTCCCACTACAGTGCAGGGATGG + Intronic
1139898610 16:70309151-70309173 TCCCAACACCAAAGCAGAAAGGG + Intronic
1141153165 16:81578776-81578798 TTCCGACGCCAGTGCAGGAAGGG - Intronic
1141808281 16:86356622-86356644 TTCCATCCCCATTTCAGAGATGG - Intergenic
1143977922 17:10844079-10844101 TGCCAATGCCAGTGCAGAGGGGG + Intergenic
1149972618 17:61234295-61234317 TTCCTACACCATTGCTGAGCAGG + Intronic
1150435222 17:65148656-65148678 TCCCAAAAAAAGTGCAGAGAGGG - Intronic
1152194411 17:78908742-78908764 TTCCAGAACTAGTGCACAGAAGG + Intronic
1152257301 17:79247724-79247746 TTCCAGCTCCAGAGAAGAGAAGG + Intronic
1152725157 17:81941532-81941554 GGCCACCACCAGCGCAGAGACGG + Exonic
1153107293 18:1542513-1542535 TACCAAGACCACTGCAGTGATGG + Intergenic
1153354039 18:4115810-4115832 TGACAAAAACAGTGCAGAGAAGG - Intronic
1154061511 18:11065267-11065289 TTCCCACACCACTCCATAGATGG + Intronic
1156838228 18:41581253-41581275 TTCCAAGACCAGTGTAGGGGTGG - Intergenic
1156947994 18:42858280-42858302 TTCATACAGAAGTGCAGAGATGG - Intronic
1159003725 18:62994555-62994577 TTCCAGCACCTGTGTAAAGATGG - Intergenic
1160720923 19:596628-596650 GTCCAACCCCAGTGCTGAGCAGG - Intronic
1160818954 19:1049254-1049276 TTCTACCAGCACTGCAGAGATGG - Exonic
1166660591 19:44644294-44644316 TTCCAACCCCGGGGCAGAGATGG - Intronic
925349574 2:3191432-3191454 TCCCATCGCCACTGCAGAGAGGG + Intronic
927136458 2:20100232-20100254 ATCCAAAACCACTGCTGAGAGGG + Intergenic
930773563 2:55151194-55151216 TTTCAACACCTGTGAAAAGATGG + Intergenic
932188268 2:69717097-69717119 TTCCAGGACCACTGAAGAGATGG - Intronic
934955092 2:98610526-98610548 TTAGAACGCCAGTGTAGAGAAGG - Intronic
935246618 2:101224415-101224437 TTCCAACACAAGCGAAGACAAGG + Intronic
936035950 2:109111538-109111560 TTGCAACACCATTGTAGAGATGG - Intergenic
941041660 2:160629862-160629884 TTCAAACAGCTGTGAAGAGAGGG + Intergenic
948642810 2:239386112-239386134 TGCCAGGACCAGGGCAGAGAAGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171012366 20:21515528-21515550 TTCCAACCCCAGCGCCGAGGAGG - Intergenic
1174471291 20:50763060-50763082 TTCCAACAGCCGAGCAGACAGGG + Intergenic
1178726810 21:35060313-35060335 TGCCAAGACCAATGCTGAGAAGG + Intronic
1178771830 21:35512003-35512025 TTCCCACACCAGCTCTGAGATGG + Intronic
1178813463 21:35905599-35905621 TTCCACGAGCAGGGCAGAGACGG + Intronic
1180550141 22:16531617-16531639 TGGCAACACCAGGGCAGAGGAGG - Intergenic
1180839255 22:18951215-18951237 CGCCAACACCAGGGCACAGAGGG + Intergenic
1181062635 22:20289241-20289263 CGCCAACACCAGGGCACAGAGGG - Intergenic
1181333580 22:22113412-22113434 TTCTTTCACCTGTGCAGAGAAGG - Intergenic
1183403488 22:37618434-37618456 TTCCAGCACCTGTGCAGGGAGGG - Exonic
949341129 3:3032117-3032139 TTTCAGCAACAGTGCAGACAAGG + Intronic
950292383 3:11795750-11795772 TTCTAACGCGAGTGGAGAGAAGG - Intronic
951940063 3:28068148-28068170 TGCCAAGACCAGAGGAGAGAGGG - Intergenic
952262552 3:31754412-31754434 ATCCAGCTCCAGTGGAGAGAGGG + Intronic
952716149 3:36483039-36483061 ATCCACCACAAGTGCACAGATGG + Exonic
954127237 3:48538791-48538813 TTCTCACACCAGTGCCAAGAGGG + Intronic
954423733 3:50432404-50432426 TTCCAACACAAGTTCAGGGCTGG + Intronic
955359601 3:58261733-58261755 TCCCAACAGCAGTGCATAGGGGG - Intronic
956210820 3:66799512-66799534 TTCCAAAATCAGTGGAGAGGAGG - Intergenic
957220678 3:77378729-77378751 ATCTAACACCGGTTCAGAGACGG - Intronic
959752129 3:109850213-109850235 TGCCAAGACCAGTGCAGCGCTGG - Intergenic
960510519 3:118543701-118543723 TACCAACACCAGTGCATTGCAGG - Intergenic
961118508 3:124352264-124352286 TTCCACCACCTGGGCAGACATGG - Intronic
962990723 3:140574836-140574858 CTCCAGCACCTCTGCAGAGAAGG + Exonic
965250254 3:166333425-166333447 TTCCAAAATAAATGCAGAGAAGG + Intergenic
965836095 3:172854468-172854490 TTCCAACACAAAGGCAAAGATGG - Intergenic
969686130 4:8675303-8675325 TGAAAACAGCAGTGCAGAGAGGG - Intergenic
970370562 4:15401439-15401461 GGCCAACAACAGTGCAGAGGGGG - Intronic
971201294 4:24511590-24511612 TACCATCACCAGTGAACAGAGGG + Intergenic
973029991 4:45325565-45325587 TCAGAACCCCAGTGCAGAGAAGG - Intergenic
978667524 4:111203012-111203034 TTCCAAGACCAATGAAAAGATGG + Intergenic
979403518 4:120280881-120280903 ATGCAACATCACTGCAGAGATGG + Intergenic
980082492 4:128358829-128358851 TTGCAACACCCGTGCAAAGTTGG + Intergenic
981582193 4:146261119-146261141 TTGCAAGAGCAGTGGAGAGAAGG - Intronic
981647428 4:147016698-147016720 TTTTTACAGCAGTGCAGAGAAGG + Intergenic
983519390 4:168691023-168691045 TTCCAACTGCAGTTCATAGATGG - Intronic
983644226 4:169973339-169973361 TCCCCAAACCAGTGAAGAGAGGG - Intergenic
985844312 5:2333180-2333202 GTCCATCACAAGTGCAGAGCAGG + Intergenic
986680519 5:10228993-10229015 TTCCTAAACCATTGCAGAAAAGG + Intronic
986973174 5:13361043-13361065 TTCAAAAAACAGTGCAGGGAGGG + Intergenic
987384965 5:17320343-17320365 CTCCAACACCAGGCCAGACAGGG - Intergenic
987938808 5:24504925-24504947 TTCTTACATCAGTGCATAGAGGG - Intronic
988717868 5:33845810-33845832 TTCCACCATGAGTGGAGAGATGG - Intronic
990834563 5:60002374-60002396 TTCCAAAAAAAGTGAAGAGAAGG + Intronic
990921066 5:60967876-60967898 TTCCAAAACAACTGAAGAGAAGG - Intronic
991310301 5:65232804-65232826 TTTCAAAAACATTGCAGAGAAGG + Intronic
991493069 5:67202067-67202089 TGCCAATAATAGTGCAGAGAGGG - Intergenic
994186212 5:96817920-96817942 TTCTCACACCACTGCAGAGTCGG - Intronic
994313690 5:98307422-98307444 TTCCAGAATCAGTGCAGAAATGG + Intergenic
994551632 5:101241244-101241266 CTCCAGCAGTAGTGCAGAGAAGG + Intergenic
997613426 5:135230708-135230730 CTCCAACACCCTTACAGAGAAGG + Intronic
1000046773 5:157528322-157528344 TTCCAGCAGCAGTGCTGAAAGGG - Intronic
1002778905 6:351783-351805 TTCCTCCACCAGATCAGAGAAGG - Intergenic
1002999969 6:2322623-2322645 TTCCAAAAAAAGTGAAGAGAAGG - Intergenic
1006200764 6:32287985-32288007 TTCCAGCACCAGTGCAAGTATGG + Intergenic
1006891373 6:37432334-37432356 TTTCAACACCTGTGAAAAGAAGG - Intergenic
1008058663 6:46973737-46973759 TTCAACCACCAGTTCAGAGAAGG - Intergenic
1008536010 6:52506684-52506706 ATCCAACACAAGGGCAGAGCTGG + Intronic
1009348015 6:62640966-62640988 TTCCAAAATCAGTTCAGAGGTGG + Intergenic
1014096795 6:117470125-117470147 GTACTACAGCAGTGCAGAGATGG - Intronic
1014227532 6:118864844-118864866 CCCCAAGAGCAGTGCAGAGAAGG + Intronic
1015482977 6:133734838-133734860 TCCCACCAGCAGTGCAGAAAGGG - Intergenic
1016241020 6:141930704-141930726 TTCCAACATCTGTGCAATGAAGG + Intergenic
1018385950 6:163303485-163303507 TTTCACCACCAGTGTAGAGGTGG + Intronic
1018443645 6:163835150-163835172 TTCCACCAACAGTGCAGCAAGGG - Intergenic
1018875375 6:167817909-167817931 TTTTACCACCACTGCAGAGAAGG - Intergenic
1019020814 6:168916035-168916057 TTCCAGCAACAGTCCAGGGAGGG + Intergenic
1026896748 7:74013821-74013843 TTCCAACACCAGGGCAGGGCGGG + Intergenic
1028296028 7:89132857-89132879 TCCCAACCACAGTGCTGAGAGGG + Intronic
1028902041 7:96112746-96112768 TTCCAACTATTGTGCAGAGAAGG - Intergenic
1031127385 7:117790488-117790510 TTCCAACACTCGGGCACAGATGG - Intronic
1033291593 7:140089165-140089187 TGCCAAAACCAGTGGAAAGATGG - Exonic
1035470296 7:159104960-159104982 TTCCAACACCAGTGGCCAAATGG - Intronic
1035487379 7:159236686-159236708 TTCCAGACTCAGTGCAGAGACGG + Intergenic
1039479765 8:37863865-37863887 ACCAAACACCAGTGCAGAGCTGG + Intronic
1041735458 8:61106354-61106376 TTCCAACAACGTTGAAGAGATGG + Intronic
1043542025 8:81274926-81274948 TTTCACCATCAGAGCAGAGATGG - Intergenic
1047489129 8:125359904-125359926 CTCCAATAGCAATGCAGAGATGG + Intronic
1048929731 8:139303595-139303617 TTCAAACACCTGTACAGACAAGG - Intergenic
1049121518 8:140743077-140743099 CTCCAGCACCATTGCTGAGAAGG + Intronic
1055839255 9:80482889-80482911 TTCTCATACCAGTGCTGAGAGGG + Intergenic
1056688404 9:88785289-88785311 TCCCAACACCATAGCAGAGGAGG - Intergenic
1056790126 9:89619921-89619943 TTCCAGCACCCCTGCAGGGAAGG - Intergenic
1058738092 9:107915007-107915029 TGCCTACACCAGTGTTGAGAGGG - Intergenic
1061884363 9:133584147-133584169 TTCAAACGCCAGAGCTGAGAGGG + Intronic
1188536016 X:31197512-31197534 TTACAACAACTGTGCATAGATGG + Intronic
1189545670 X:42040266-42040288 TTCCAACATCAGGGTAGGGAAGG - Intergenic
1191669676 X:63737554-63737576 ATACAACACCAGTACAGGGATGG + Intronic
1193894780 X:87099889-87099911 AGCCAGCACCAGTGCAGGGAGGG + Intergenic
1197168609 X:123406775-123406797 TTCCAACACCAGTGCAGAGAGGG + Intronic
1199849629 X:151716134-151716156 TCCCAACACCAAGGCGGAGATGG + Exonic