ID: 1197169053

View in Genome Browser
Species Human (GRCh38)
Location X:123410840-123410862
Sequence GTGTCTCTGTAGCTGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197169053_1197169055 21 Left 1197169053 X:123410840-123410862 CCTTCATCCAGCTACAGAGACAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1197169055 X:123410884-123410906 TTAACTCTCTCAGCTCCCCAAGG 0: 1
1: 0
2: 0
3: 23
4: 218
1197169053_1197169056 27 Left 1197169053 X:123410840-123410862 CCTTCATCCAGCTACAGAGACAC 0: 1
1: 0
2: 3
3: 15
4: 206
Right 1197169056 X:123410890-123410912 CTCTCAGCTCCCCAAGGACAAGG 0: 1
1: 0
2: 11
3: 78
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197169053 Original CRISPR GTGTCTCTGTAGCTGGATGA AGG (reversed) Intronic
900641023 1:3688086-3688108 GAGGATCTGTAGCTGGAGGAAGG + Intronic
900708162 1:4093650-4093672 GTGTCTCAGGGGCTGGATGTGGG + Intergenic
902725127 1:18330485-18330507 ATGCCACTGTAGCTGGAGGAAGG + Intronic
902992645 1:20199955-20199977 ATGTCTCTGGAGCTGGATTCTGG + Intergenic
905347209 1:37319264-37319286 GTGTGTGTGTACCTGGGTGAGGG + Intergenic
906034221 1:42740680-42740702 GGGGCTCTGAAGCTGGATGTGGG + Intergenic
907111645 1:51931804-51931826 GGGTCTCACCAGCTGGATGAGGG + Intronic
907152227 1:52299699-52299721 GGCTCTCAGCAGCTGGATGATGG + Intronic
908998656 1:70190862-70190884 GTGTTTCTGTTGGTGGATGGAGG + Intronic
909495958 1:76279055-76279077 TTGTCACTGTTGCTGGCTGAGGG + Intronic
910804068 1:91173195-91173217 TTGTCTCTGGATCAGGATGAAGG + Intergenic
911852098 1:102833267-102833289 GTATCTCTGTAGGGGGCTGAAGG + Intergenic
912440089 1:109691123-109691145 CTGTGGCTGTAGCTGGATTAAGG + Intronic
913346726 1:117817306-117817328 GTGTATCTGTAGCAGGATGGGGG + Intergenic
916425287 1:164674479-164674501 CTGTCTCTGTAACTGGAAAATGG - Intronic
916583307 1:166127740-166127762 GTGTGTCTGTAGCAGGCGGAGGG + Intronic
916806551 1:168266223-168266245 GCGTATCTGTAACTGGATGGGGG + Intergenic
919470807 1:197976983-197977005 TTATCTATGTAGCTGGAGGATGG + Intergenic
919506620 1:198406925-198406947 ATGTCACTGTAGGTGGAGGATGG - Intergenic
920190204 1:204188980-204189002 GTGTCTCTGTACCTCTAGGAGGG - Intergenic
920718747 1:208367291-208367313 GTCTCTCAGAAGCTGGAAGATGG - Intergenic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
923098718 1:230795505-230795527 GTGCCTCTGTGGGAGGATGATGG + Intronic
923765594 1:236889992-236890014 GTGTCTCTGTCGGTGGATTCTGG - Intronic
1062881806 10:985066-985088 GTGTCTCTCCAGCTGTGTGACGG + Intergenic
1064436179 10:15313113-15313135 GTGTCTCTGGAGCTGGTTTCTGG - Intronic
1067286385 10:44910615-44910637 GTGTCCCTGTAGCTGTTTCAAGG - Intergenic
1069587241 10:69616204-69616226 GTGTATCTGTAACTGGATTCTGG + Intergenic
1069749649 10:70737012-70737034 TTGTCTCTGTAATTGGCTGAGGG + Intronic
1070558340 10:77546900-77546922 GTCTCACTGTTGCTGGGTGATGG - Intronic
1070650805 10:78234768-78234790 CTCTCTCTGGAGCTGTATGAAGG - Intergenic
1072070408 10:91909601-91909623 CTGTCTCTCCAGATGGATGATGG + Intergenic
1072419014 10:95273699-95273721 CTGTCCCAGTGGCTGGATGAGGG - Intronic
1073486377 10:103821515-103821537 TTGTGTCTGGAGCTGGCTGATGG - Intronic
1075178053 10:120184155-120184177 GCTTCTCTGTGGCTGGGTGAGGG - Intergenic
1076674660 10:132141781-132141803 GGGTCTCTCTAGCAGCATGAGGG - Intronic
1077475852 11:2790131-2790153 CTGTCTCTGTGGCAGGTTGAGGG - Intronic
1077797879 11:5509921-5509943 GTGGCTGTGTAGCAAGATGAGGG - Exonic
1078480771 11:11673360-11673382 GTATCTCTCTATCTGGATGCTGG + Intergenic
1080882342 11:36334139-36334161 GTGTCTCTGTGACTAGAAGATGG - Intronic
1084958195 11:72702544-72702566 GTGTCTGTGTTGCTGCGTGAGGG - Intronic
1085270376 11:75266595-75266617 GTGGCTCTGTAGCCAGAGGAAGG + Intronic
1086902905 11:92387581-92387603 GTGTCTGTGTGGCTGGATGTAGG + Intronic
1086992411 11:93318424-93318446 GTGTCTTTGGAACTGGATGTGGG + Intergenic
1088395432 11:109362754-109362776 GTGTCTCTGTATCAGAAAGATGG - Intergenic
1088967881 11:114742721-114742743 ATGTTTCTGTAGGGGGATGATGG + Intergenic
1091623193 12:2105436-2105458 CTGTGTCTGTAGCAGGATGGGGG + Intronic
1092073286 12:5651203-5651225 GTGTCTATGTCCCTTGATGATGG + Intronic
1092921554 12:13236222-13236244 GTGTCTCTATTTCTGGGTGAAGG + Intergenic
1094386239 12:29896753-29896775 GTGGCTTTGGAACTGGATGATGG - Intergenic
1095474396 12:42571135-42571157 GTTTCTCAGTGGCTGGATAAAGG - Intronic
1095758706 12:45801865-45801887 GTGTATCTGGATCTGGATGAAGG + Intronic
1097621014 12:61939918-61939940 GTTTCTCTGTAGGTGGAAGCAGG - Intronic
1098302025 12:69064193-69064215 GTGGCTTTGTAGCTGGGTAATGG - Intergenic
1100929165 12:99585905-99585927 CTGTCTCTGGGCCTGGATGAGGG + Intronic
1101220169 12:102630734-102630756 GCGTCTCTGTTGTTGGAAGAGGG + Intergenic
1101927353 12:108983639-108983661 GAGGCTGTGGAGCTGGATGATGG - Exonic
1102887837 12:116534890-116534912 GAGTCTGGGTAGCTGGATGCTGG - Intergenic
1104365086 12:128169554-128169576 GTATCTCTGCAGATGGATGAGGG - Intergenic
1104597052 12:130127021-130127043 GTGGCTCTGAAGCTGGAGGAAGG + Intergenic
1112407479 13:99134146-99134168 GTGTGTTTGTAGATGCATGAAGG + Intergenic
1117886428 14:60369069-60369091 GTGTCTCTGTAGGGGAAGGAAGG - Intergenic
1119672674 14:76531325-76531347 GTGTCTTTGCAGCTGTATTAAGG - Intergenic
1122819888 14:104336210-104336232 GTGTTTCTGAAGCTGGAAGGGGG + Intergenic
1125475867 15:40047682-40047704 GTGTCCCTGGAACTGGACGAGGG + Intergenic
1126066821 15:44832092-44832114 GTGTGTGTGTAGCTGTATGGTGG - Intergenic
1127016374 15:54693048-54693070 GTGTATCTGTAACTGGAGAAAGG + Intergenic
1127834664 15:62781128-62781150 TCTCCTCTGTAGCTGGATGAAGG + Exonic
1129983439 15:79895862-79895884 GTGTCTCTGAAGCATGATGCTGG + Intronic
1132148206 15:99441047-99441069 GTGTCACTGTAGCGGGGTGGGGG + Intergenic
1132731795 16:1366498-1366520 CTGTCTCTGTAGCTGGTGGCCGG - Intronic
1133295338 16:4749148-4749170 GGGTCTCTGTAGGTGGGAGAGGG - Exonic
1133551885 16:6864119-6864141 GAGTCTCTTTAGCAGGAAGAAGG + Intronic
1136037477 16:27550838-27550860 CTGTCTCTGGAGCTGAATTATGG + Intronic
1137321791 16:47391359-47391381 GTATCTCTGTAGATGAATGTGGG + Intronic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1142896366 17:2981563-2981585 GTGACTCTGTAGCTGGGGGCTGG + Intronic
1143406511 17:6681224-6681246 GTGGCTCTGCAGCTGGAAGGGGG + Intergenic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1147962513 17:44176844-44176866 GTGGCTCTGTACCTGGAGCATGG + Exonic
1152071421 17:78135617-78135639 GAATTTCTGCAGCTGGATGAGGG - Intronic
1154027608 18:10723480-10723502 GTGGGGCTGTAGCTGGAGGAGGG + Intronic
1154162821 18:11992520-11992542 ATGTCTCTGAAGCTGGTTGATGG + Intronic
1155175511 18:23298156-23298178 GAGTCTCAGTTGCAGGATGAGGG - Intronic
1156600837 18:38604174-38604196 GTGTCTGTGTAAAGGGATGAGGG + Intergenic
1157188063 18:45557599-45557621 GCTTCTCTGGAGTTGGATGACGG + Intronic
1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG + Intergenic
1160507470 18:79435229-79435251 TTTTCACTGTATCTGGATGAGGG + Intronic
1161059338 19:2207254-2207276 GTGCCTGTGTTGCTGGATGCTGG + Intronic
1161059679 19:2208643-2208665 GTGTCTCTGCTTCTGGAAGAGGG - Intronic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1163291186 19:16380274-16380296 GTGTCTGTGTGGCTAGATGCTGG - Intronic
1166409003 19:42543788-42543810 GTGTCTCTGTACCTGAGTGGTGG + Intronic
1166616610 19:44254141-44254163 TTTTCTCTGCAGCTGGGTGATGG + Intronic
925967529 2:9079798-9079820 TTTTCTTTGTAGCTTGATGATGG - Intergenic
926132178 2:10310588-10310610 GGGTCTCTGTAGGTGCATCAGGG - Intronic
926989286 2:18660125-18660147 GGATCTCTGTAGCTGGGTGGAGG + Intergenic
928082163 2:28321130-28321152 GTGTGTCCGTAGCTGTATGATGG + Intronic
928441985 2:31299900-31299922 CTCTCTCTGCAGCTGGATGGAGG + Intergenic
929037762 2:37711191-37711213 GTGACTCTGAAGATGGAGGAGGG + Intronic
929331698 2:40690112-40690134 GTGTCTATGTGTATGGATGAAGG + Intergenic
929565711 2:42983179-42983201 GGGTCTATGCAGCTGGTTGAGGG - Intergenic
930073257 2:47385737-47385759 GTGTCTTTGTAGTTGTATGTGGG + Intronic
934514353 2:94976506-94976528 GTTTCTCAGTAGGTGGATGGTGG - Intergenic
934912244 2:98269777-98269799 GTGTCTCTGTAGGGGAATGAGGG + Intronic
935605297 2:104966486-104966508 GTGTCTCTGTAGAGGAAGGAGGG + Intergenic
935642963 2:105308086-105308108 GTGTCTCTGCAGCTGTTTGGTGG + Exonic
936803458 2:116295007-116295029 GTGTCTCTGTAGGGAAATGAGGG + Intergenic
937083536 2:119156869-119156891 GTGTATGTGAAGCTGGATGGCGG - Exonic
937863339 2:126730355-126730377 GTGTCTCTGTTGCTCAGTGAGGG - Intergenic
938473466 2:131587324-131587346 GTGTCACTTTAGGTGGAGGAAGG - Intergenic
938695651 2:133833144-133833166 GGCACTCTGTAGTTGGATGATGG - Intergenic
939493888 2:142906120-142906142 CTGTCTCTGTAGATGGATTTTGG + Intronic
940471288 2:154104137-154104159 GTGTCTCTGTGAATGGAAGATGG - Intronic
943923198 2:193737678-193737700 GTGTCTCTGGCACTGGAGGAGGG + Intergenic
945599115 2:211836215-211836237 GTGTCTATATATCTGAATGAAGG - Intronic
945812662 2:214567535-214567557 GTGTGTGTGTATGTGGATGAAGG - Intronic
946745402 2:222840331-222840353 GTATCTCTGGGGTTGGATGATGG - Intergenic
1170917203 20:20638791-20638813 GTGTTTCTGTTGCTGGCTAAAGG + Intronic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1173043754 20:39490281-39490303 GGGCCTCTGTAGCTGGGGGAGGG - Intergenic
1175685371 20:61024432-61024454 GTGTCCCTGTAGCTGGGTCGGGG - Intergenic
1176407696 21:6430402-6430424 GTGGCTCTGTACCTGGTAGAAGG + Intergenic
1177651416 21:23965328-23965350 TTGTATCTGTAGCTGGATGGGGG + Intergenic
1179683186 21:43038733-43038755 GTGGCTCTGTACCTGGTAGAAGG + Intergenic
1180008935 21:45037121-45037143 GTTTCTCGGTTTCTGGATGAGGG - Intergenic
1181027452 22:20134162-20134184 GTGTCCCTGTAGCAGGATGGTGG + Intronic
1182986640 22:34724696-34724718 GTATTTCTGTAGGAGGATGAGGG - Intergenic
1184077021 22:42187459-42187481 GTGTCTCTGTGGCTGAGTGGTGG + Intronic
1184293513 22:43510151-43510173 GTGTCTCTGGAGCCAGATGTGGG + Intergenic
1185300442 22:50077218-50077240 GGGGCTCTGGAGCTGGGTGAGGG - Intronic
950114234 3:10440134-10440156 GTGTCTCTGTCTCTGGTTCATGG + Intronic
952601164 3:35084967-35084989 GTGTGTCTGCTACTGGATGATGG + Intergenic
954535996 3:51359706-51359728 GTATTTCTGTAGCTGGAGAAAGG - Intronic
955714043 3:61810035-61810057 GAGCCTCTGTAGCTGGAAGTGGG + Intronic
956554528 3:70503852-70503874 ATGGCTCAGTACCTGGATGACGG + Intergenic
959162725 3:102740177-102740199 GTGTATCTGCAGCTGGATGAGGG - Intergenic
959433333 3:106282898-106282920 GTGGCTCTGGAGCTGGGTAATGG + Intergenic
963549488 3:146702313-146702335 CTGCCTCTCTAGCTTGATGAGGG - Intergenic
964432933 3:156624541-156624563 ATGTATCTGTAACTGAATGAGGG - Intergenic
965121978 3:164571343-164571365 GAGTCTGTGAAGCTGGATTAAGG - Intergenic
966587923 3:181648430-181648452 GGTTGTCTGTAGATGGATGAGGG + Intergenic
967100584 3:186212158-186212180 AGGTCTCTGTAGCTGCATTAAGG + Intronic
967754952 3:193158227-193158249 GTGTCTCTATAGCTGGGTACTGG + Intergenic
968817685 4:2830173-2830195 GGGTCCCTGTAGCTGGAGGCAGG - Intronic
970055218 4:11964346-11964368 TTGTCTCTGTAGCTGATTGTGGG - Intergenic
970813627 4:20126892-20126914 GTGTCTCTGTGGATGGAAGGTGG - Intergenic
974904583 4:68039003-68039025 CTGTCTCTGTTGCTGGAAGCTGG - Intergenic
975762402 4:77632531-77632553 GTGTATCTGTAGTTGGATGGGGG + Intergenic
977618234 4:99108573-99108595 CTGTCTCTGTAGGTGGATTTTGG + Intergenic
978376489 4:108079541-108079563 GTGTTACAATAGCTGGATGAGGG + Exonic
978928642 4:114283195-114283217 CTGACTTTGTAGCTGGAGGAAGG - Intergenic
980169090 4:129265334-129265356 GTGTGTCAGGAGCTGGAAGACGG - Intergenic
981470847 4:145132766-145132788 GTGTGTTTGTGGCTGGATGGGGG - Intronic
983353499 4:166625205-166625227 CTGTCTCTGAAGCTGGCAGAAGG + Intergenic
984002032 4:174259730-174259752 TTGTATATGCAGCTGGATGAAGG - Exonic
984635276 4:182103670-182103692 GTTTTTCTGAAGTTGGATGAAGG - Intergenic
986799727 5:11246707-11246729 GTGTGTCTGTAGGTGGGTGGGGG + Intronic
987588978 5:19897927-19897949 CTGTTTCTTTATCTGGATGAAGG + Intronic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
991416351 5:66396783-66396805 GTGTCTTTGTGGCGGGACGAAGG + Intergenic
992607294 5:78471682-78471704 TTGTCTCTGAAGCTGCATTAAGG + Intronic
994064736 5:95525905-95525927 GTGGTTTTGTAGCTGGATGATGG - Intronic
994506502 5:100649358-100649380 TTGTCTCTGTATGTGGATGGTGG - Intergenic
995851914 5:116555094-116555116 GTGTCTCTGGAGCTGGATAATGG - Intronic
996169386 5:120269855-120269877 GTGTCACTTTGGCTGGATTAAGG - Intergenic
996550467 5:124725029-124725051 GAGTGACTGAAGCTGGATGAGGG - Intronic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1002919298 6:1555041-1555063 TTGCCTCTGAAGCTGGATGGTGG + Intergenic
1003892404 6:10575308-10575330 GTGTCTGTTTAACTGGAAGATGG + Intronic
1007198561 6:40085258-40085280 GTAGCTCTGGAGCTGGTTGAGGG - Intergenic
1007331087 6:41109701-41109723 GTGTCTTTATAGATTGATGAAGG + Intergenic
1007817278 6:44533527-44533549 CTGGCTTTGTAGCTGGATGCAGG + Intergenic
1009748204 6:67847689-67847711 GAGTCTATGTAGTTGGAGGAGGG + Intergenic
1010131909 6:72504109-72504131 ATGTCTCTGTAGGTGGAGGTAGG - Intergenic
1011263553 6:85492369-85492391 TTGTCTCTGGGGTTGGATGAAGG - Intronic
1012521981 6:100132392-100132414 GTGTTTCTGTGGCAGGATGAGGG + Intergenic
1013270538 6:108541892-108541914 GGTTCTCTGTAGCTGAATGGAGG + Intergenic
1013319452 6:108972698-108972720 GTGTCTCTTAGGCTGGATGGCGG + Intronic
1017804469 6:157931838-157931860 GTGTCTCTGCATCTGGTAGAGGG + Intronic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1018743262 6:166746034-166746056 GTGTCTCAGTAGCTGCAACACGG - Intronic
1020012586 7:4814880-4814902 GTGGCTCTGAGGCTGGAGGAGGG - Intronic
1021946105 7:25728984-25729006 GTGTTTCAGTAGCAGAATGATGG - Intergenic
1022321649 7:29293559-29293581 GTGTGTCTGGAGCTGAGTGAGGG - Intronic
1022596268 7:31716088-31716110 GTGTCTTTGTGGCTGGATCCAGG + Intergenic
1022597220 7:31724157-31724179 GTGTCTTTGTGGCTGAATGCAGG + Intergenic
1023205219 7:37741726-37741748 GTGTCTTTGGAGCTGGGTGGTGG - Intronic
1023267768 7:38426022-38426044 GTGTATCTGTATTTGGATGTGGG + Intronic
1026543745 7:71303487-71303509 GGGTCTGTGTAAATGGATGAGGG + Intronic
1027750147 7:82133461-82133483 ATGTCTCTGTACCTTAATGATGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1030183650 7:106737382-106737404 GTGTTTCTGTAGAAGAATGAGGG + Intergenic
1032234204 7:130105810-130105832 GTGTTTCTTGAGCTGGATGGTGG + Intronic
1033133445 7:138765230-138765252 GTGGAACTGAAGCTGGATGATGG - Intronic
1034342032 7:150363667-150363689 GTGGCCCTGTATCTGGAAGAGGG - Intergenic
1036057146 8:5268521-5268543 GTTTCTCAGTACCTTGATGAAGG + Intergenic
1038634614 8:29275567-29275589 GTGTCTTTGTATATGGATGTAGG - Intergenic
1043328950 8:79089374-79089396 GTTTATCTGTAGCTTAATGATGG - Intergenic
1048025217 8:130579756-130579778 GTGTCTATGTAACAGGATGAAGG - Intergenic
1049229168 8:141473188-141473210 GTGGCTCTGAAGTAGGATGAGGG + Intergenic
1049409342 8:142465423-142465445 GAGCCTCTGGGGCTGGATGATGG + Intronic
1051245315 9:15104610-15104632 GTGTCTCTGTAGGGGAAAGAAGG - Intergenic
1051880455 9:21834581-21834603 CTGGCTCTGAAGATGGATGAGGG - Intronic
1053351982 9:37419144-37419166 ATGGCTCTGAAGCTGGGTGATGG + Intergenic
1054770447 9:69078459-69078481 GAGACTGTGTAGCTAGATGATGG - Intronic
1055762344 9:79622341-79622363 ATGTCTGTGTGGCTGGAAGAGGG - Intronic
1057239195 9:93393097-93393119 GTGTGTCTGTAGCTGGATGCGGG + Intergenic
1061383896 9:130276878-130276900 GGGTCACTGCAGCTGGAGGAGGG + Intergenic
1061872725 9:133529308-133529330 GGGTCTCTGTAAATGGAAGATGG - Intergenic
1187288389 X:17928596-17928618 GTGTCTCTGAGGGTGGACGAGGG + Intergenic
1187400610 X:18956635-18956657 GCTTCTCTGTAGTTGAATGAGGG - Intronic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1187447257 X:19370742-19370764 GTGTCCCTGAAGCATGATGAAGG - Intronic
1188657070 X:32711160-32711182 TTTTCTCAGTGGCTGGATGAGGG + Intronic
1191908183 X:66118362-66118384 GTGTCTCTGTGTCTGGGTTAGGG + Intergenic
1193278580 X:79621114-79621136 ATTTCTCTGGAGCTGGATAAGGG + Intergenic
1194450294 X:94037578-94037600 GTGTTTCTGTAGGAGAATGAGGG + Intergenic
1194653864 X:96547881-96547903 GTGTGTGTGTAGCTGGGGGAAGG - Intergenic
1196135808 X:112208629-112208651 CTGTCTCACTAGCTAGATGAGGG + Intergenic
1197169053 X:123410840-123410862 GTGTCTCTGTAGCTGGATGAAGG - Intronic
1199553030 X:149078254-149078276 GTGTATCTGTAGCTGGATAGGGG - Intergenic
1200935235 Y:8732621-8732643 AAGTCTCTGTAGCTTGGTGAAGG - Intergenic
1201254180 Y:12090956-12090978 GTTTCTCTATAGCTGGAGGTGGG - Intergenic
1201979499 Y:19891779-19891801 GTGTGACTGTTGCTGGAGGATGG - Intergenic