ID: 1197169698

View in Genome Browser
Species Human (GRCh38)
Location X:123418199-123418221
Sequence CATTGAAAGGAGAAGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1112
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 1046}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197169698 Original CRISPR CATTGAAAGGAGAAGGTAGG AGG (reversed) Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901620357 1:10580466-10580488 CTTTGAAAGGTCAAGGCAGGTGG - Intronic
901663058 1:10810881-10810903 AAATGAAAGCAGAAGGTTGGAGG - Intergenic
901716187 1:11156501-11156523 TAGGTAAAGGAGAAGGTAGGGGG - Intronic
901750113 1:11401309-11401331 CTTTGAAAGGCCAAGGCAGGCGG - Intergenic
901750624 1:11405142-11405164 AATTGAAAGAAGAAAGGAGGGGG - Intergenic
901778487 1:11576803-11576825 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
902253839 1:15174483-15174505 CTTTGAAAGGCTAAGGCAGGAGG - Intronic
902446338 1:16467142-16467164 CTTTGAAAGGCTGAGGTAGGAGG + Intergenic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902827187 1:18984144-18984166 CTTTGGAAGGTGGAGGTAGGAGG + Intergenic
903051108 1:20601883-20601905 CCTTGAGAGGCCAAGGTAGGTGG + Intronic
903105083 1:21071159-21071181 CCTTGAAAGGCTAAGGCAGGAGG + Intronic
903173928 1:21569662-21569684 CATTGCTAAGAGAAGGCAGGGGG + Intronic
903208892 1:21804304-21804326 CTTTGGAAGGGCAAGGTAGGAGG - Intergenic
903409196 1:23126372-23126394 CATTGGGAGGATAAGGCAGGAGG + Intronic
903714012 1:25349696-25349718 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
903845487 1:26277599-26277621 CATTGGATGGAGAAGAAAGGTGG - Exonic
903893741 1:26588457-26588479 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904052664 1:27649208-27649230 CATTGAGAGGCCAAGGTGGGAGG - Intergenic
904064867 1:27741635-27741657 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
904119156 1:28184881-28184903 CTTTGAAAGGCCGAGGTAGGTGG - Intronic
904362552 1:29986225-29986247 CATTGATTGGAGGAGGTAAGAGG - Intergenic
904656161 1:32049297-32049319 CTTTGGAAGGCCAAGGTAGGCGG - Intronic
904993514 1:34613086-34613108 CTTTGGAAGGCCAAGGTAGGCGG + Intergenic
905073238 1:35246463-35246485 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
905090531 1:35427751-35427773 CTTTGAAAGGATGAGGCAGGTGG - Intergenic
905116281 1:35643531-35643553 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
905130572 1:35753332-35753354 CTTTGGAAGGACAAGGCAGGAGG - Intronic
905153411 1:35951630-35951652 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
905162994 1:36053516-36053538 CTTTGGGAGGACAAGGTAGGTGG - Intronic
905679588 1:39859007-39859029 CTTTGAAAGGCCAAGGCAGGCGG + Intronic
905781853 1:40718411-40718433 TATGGAAAAGAGAAGGTAGGAGG - Intronic
906043584 1:42809284-42809306 AATTGAAAAGACAAGGAAGGGGG + Intronic
907089329 1:51709737-51709759 CACTGTGAGGAGTAGGTAGGAGG - Intronic
907179969 1:52560955-52560977 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
907539315 1:55198223-55198245 CGTTGGAAGGCCAAGGTAGGAGG - Intronic
908053752 1:60260551-60260573 TTTTGATAAGAGAAGGTAGGAGG + Intergenic
908270339 1:62415824-62415846 CATTGAAAGGTTCAGGCAGGTGG - Intergenic
908273438 1:62444013-62444035 CTTTGGGAGGTGAAGGTAGGTGG + Intronic
908770034 1:67587604-67587626 CGTTGAAATGACAAGGAAGGAGG - Intergenic
909306745 1:74090642-74090664 CTTTGAAAGGCCAATGTAGGAGG + Intronic
909585819 1:77286601-77286623 CTTTGGAAGGCGGAGGTAGGTGG + Intronic
909738692 1:79000470-79000492 CTTTGAAAAGAGAAGGAAAGGGG - Intronic
910144470 1:84063306-84063328 CTTTGGGAGGAGAAGGCAGGTGG - Intergenic
910149398 1:84124574-84124596 CATAAAGAGGTGAAGGTAGGGGG - Intronic
910397887 1:86809898-86809920 CATTGAGAGGTGAAGCTAGCTGG - Intergenic
910594902 1:88969899-88969921 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
910611042 1:89142492-89142514 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
910873038 1:91852461-91852483 AATCTAATGGAGAAGGTAGGTGG + Intronic
910879622 1:91911233-91911255 CATTGAGAGGCCAAGGAAGGAGG - Intergenic
910937740 1:92499429-92499451 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
910993213 1:93077279-93077301 CTTTGAAAGGCCAAGGTAGAAGG - Intergenic
911295592 1:96110993-96111015 ATTTGAAAGGAGAAGGTACAAGG + Intergenic
911527890 1:99007296-99007318 CATTTAAAGGAGAAGACAGAAGG - Intergenic
911534794 1:99087839-99087861 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
911785830 1:101945702-101945724 CTTTGAAAGGCCAAGGTAGGAGG + Intronic
912035781 1:105310869-105310891 CATTGGAAGGCCAAGGCAGGTGG - Intergenic
912074438 1:105854772-105854794 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
912273560 1:108233593-108233615 CACTGAAACTAGAATGTAGGAGG + Intronic
912294660 1:108460729-108460751 CACTGAAACTAGAATGTAGGAGG - Intronic
912672174 1:111640714-111640736 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
912971566 1:114288686-114288708 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
913243844 1:116854134-116854156 TATGGAAGGGGGAAGGTAGGGGG - Intergenic
914247947 1:145899752-145899774 CTTTGGGAGGCGAAGGTAGGAGG - Intronic
914325476 1:146611191-146611213 CTTTGAGAGGACAAGGTAGGAGG - Intergenic
914911111 1:151787726-151787748 CTTTGAGAGGCTAAGGTAGGAGG + Intronic
914964627 1:152243827-152243849 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
915269387 1:154742930-154742952 GATTAAAAGGAGAAGCTGGGAGG - Intronic
915323170 1:155067163-155067185 TCTAGAAAGGAGAAAGTAGGAGG + Intronic
915376916 1:155404428-155404450 CTTTGGAAGGACAAGGCAGGAGG + Intronic
915407249 1:155670054-155670076 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
915419996 1:155772785-155772807 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
915492958 1:156261642-156261664 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
915551956 1:156640660-156640682 CATTGGAAGGCCAAGGTGGGCGG - Intergenic
915726200 1:158019457-158019479 GATTGAGAGGGGGAGGTAGGAGG + Intronic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916357759 1:163932191-163932213 CAATGAAAGGACAATGTAGCAGG + Intergenic
917077949 1:171225580-171225602 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917788027 1:178480382-178480404 AATTTAAAGCAGAAGGTAGGTGG + Intergenic
918037839 1:180893095-180893117 CCTTGAAAAAAGAAGGAAGGGGG + Intergenic
918063936 1:181086910-181086932 CTTTGGAAGGACAAGGTGGGCGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918274428 1:182938715-182938737 CTTTGGGAGGACAAGGTAGGAGG - Intronic
918322009 1:183373370-183373392 CATGGAAAGGAGAAGGGAGAAGG - Intronic
918328098 1:183429507-183429529 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
918654082 1:187002677-187002699 AATTGAAAGAAGAGGGCAGGAGG + Intergenic
919111228 1:193221177-193221199 CATTGAGAAGAGAAGATTGGAGG + Intronic
919250697 1:195053111-195053133 CATTGGGAGGCGGAGGTAGGCGG + Intergenic
919691945 1:200535634-200535656 CCTTGAGAGGACAAGGCAGGAGG - Intergenic
919731212 1:200914692-200914714 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
919818406 1:201456648-201456670 AACTGAAAGGTGAAGGTGGGGGG + Intergenic
920226953 1:204446155-204446177 CACGGAAAGGAGAAGGTGGTGGG + Intronic
920354072 1:205357213-205357235 CATAGAAAGGCAAAGGTATGGGG - Intergenic
920393506 1:205626525-205626547 AATTGCAAGGGGAAGGTAGGAGG + Intronic
920431654 1:205922657-205922679 CTTTGGAAGGCTAAGGTAGGTGG + Intronic
920636175 1:207706123-207706145 GATGAAAAGGAGAAGATAGGTGG + Intronic
920799495 1:209173655-209173677 CATTGACAAGAGGAGGTGGGTGG - Intergenic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921448845 1:215278959-215278981 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
921572620 1:216797131-216797153 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922313085 1:224414734-224414756 CTTTGGAAGGACAAGGTGGGAGG + Intronic
922519697 1:226238385-226238407 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
922690932 1:227690329-227690351 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
922728290 1:227936433-227936455 CTTTGAAAGGCCAAGGTAGGTGG - Intronic
923568232 1:235092553-235092575 CATTAACAGGAGAAGTGAGGCGG - Intergenic
923739878 1:236645563-236645585 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
923765852 1:236891724-236891746 CCTTGAAAGGGGAAGACAGGTGG + Intronic
924321933 1:242859402-242859424 CTTTGAAAGGGCAAGGCAGGTGG + Intergenic
924757388 1:246953677-246953699 CTTTGAGAGGACAAGGTAGGTGG + Intronic
1063002235 10:1935351-1935373 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1063154877 10:3369651-3369673 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1063419795 10:5902853-5902875 AATTGAAAGGACAAAGTTGGGGG + Intronic
1063488114 10:6438839-6438861 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1063658740 10:8017926-8017948 CATTGAAAGGAGAACAAAGGCGG - Intergenic
1063714000 10:8509343-8509365 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
1064186469 10:13166390-13166412 CGTTGAAAGGCCAAGGCAGGTGG + Intronic
1064196741 10:13249906-13249928 CTTTGAAAGGCCGAGGTAGGCGG + Intergenic
1064244909 10:13660503-13660525 CCTTGTGAGGAGAATGTAGGGGG + Exonic
1064275755 10:13903483-13903505 CTTTGGAAGGTGAAGGCAGGAGG + Intronic
1064379087 10:14824360-14824382 CTTTGAGAGGACAAGGCAGGTGG + Intronic
1064447468 10:15408330-15408352 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1064551245 10:16503162-16503184 CTTTGAGAGGACAAGGTGGGTGG - Intronic
1064598129 10:16966690-16966712 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1064734769 10:18370541-18370563 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1064810191 10:19188176-19188198 CATTGAAAAGAGATAGAAGGGGG + Intronic
1065031141 10:21587154-21587176 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1065212257 10:23415481-23415503 CATTGGAAGGCCAAGGTGGGTGG - Intergenic
1065464215 10:26001736-26001758 CTTTGAAAGGATGAGGCAGGAGG + Intronic
1065743051 10:28814378-28814400 CTTTGGAAGGATAAGGCAGGAGG - Intergenic
1065926757 10:30441398-30441420 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1065994169 10:31040944-31040966 CATTGGAAGGCTAAGGTAGGAGG + Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066298459 10:34076200-34076222 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1066305768 10:34139170-34139192 CATAGAAAGGAGAAGATAGTAGG + Intronic
1067410706 10:46061837-46061859 CATTGGAAGGCCAAGGCAGGAGG - Intergenic
1067524323 10:47029106-47029128 CATGGAGCGGAGAAGGAAGGAGG - Intergenic
1068082420 10:52336169-52336191 CTTTGGGAGGTGAAGGTAGGTGG + Intergenic
1068534188 10:58222126-58222148 CTTTGGGAGGCGAAGGTAGGAGG - Intronic
1068597865 10:58923300-58923322 CACTGACAGGTGAAGATAGGTGG - Intergenic
1068731813 10:60366582-60366604 CATTGAAGGAAGAAAGAAGGGGG + Intronic
1068999469 10:63247495-63247517 CTTTGAAAGGACAAAGAAGGTGG + Intronic
1069071375 10:63993545-63993567 CACTTAAAGGAGAAGGAAAGAGG - Intergenic
1069468290 10:68661726-68661748 CATTGAGAGGCCAAGGTAGGAGG - Intronic
1069671045 10:70204093-70204115 CTTTGGGAGGACAAGGTAGGTGG + Intronic
1070040475 10:72773138-72773160 CTTTGAAAGGCTAAGGTAGGAGG - Intronic
1071355135 10:84786115-84786137 CTTTGGAAGGACAAGGTGGGTGG + Intergenic
1071412672 10:85412461-85412483 CATTGGATGGAGAAAGCAGGAGG - Intergenic
1071878950 10:89873970-89873992 CCTTGAAAGGCCAAGGCAGGTGG - Intergenic
1072674418 10:97454732-97454754 TCTCGAAAGGAGAAGGTGGGTGG - Exonic
1072679453 10:97496022-97496044 CTTTGAGAGAACAAGGTAGGCGG - Intronic
1072687691 10:97548550-97548572 CTTTGAAAGGCCAAGGCAGGCGG + Intronic
1072758999 10:98040495-98040517 CTTTGAGAGGAAGAGGTAGGAGG + Intergenic
1073013448 10:100379572-100379594 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
1073251829 10:102124887-102124909 CATTGGAAGGTCAAGGCAGGAGG - Intergenic
1073390170 10:103169371-103169393 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1073412809 10:103356304-103356326 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1073557693 10:104468455-104468477 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1073857830 10:107697631-107697653 CATTAAAAGAGGAAGGGAGGAGG - Intergenic
1074072854 10:110090462-110090484 CTTTGGAAGGCCAAGGTAGGCGG - Intronic
1074105647 10:110388028-110388050 CATTGAGAACAGAAGGTAGAAGG + Intergenic
1074106063 10:110390510-110390532 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1074439751 10:113466330-113466352 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
1074796994 10:116957030-116957052 CTTTGGAAGGACAAGGTGGGAGG - Intronic
1075262025 10:120971291-120971313 CATTTCAAGGAGAAGGTAAAGGG + Intergenic
1075639770 10:124056346-124056368 CATTCAAAGGAGATTGAAGGAGG - Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077245748 11:1537045-1537067 CATTGGGAGGCCAAGGTAGGCGG + Intergenic
1077524909 11:3058099-3058121 CCTTGAAAGGACAAGGCAGGAGG + Intergenic
1077719754 11:4616092-4616114 AAAGGAAAGGAGAAGGGAGGGGG - Intergenic
1078247170 11:9584387-9584409 CTTTGAAAGGCTGAGGTAGGAGG - Intronic
1078595599 11:12683756-12683778 AATTGAAAGGAGTAGGAGGGGGG + Intronic
1078890748 11:15556252-15556274 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1079243091 11:18734575-18734597 CATTGAGAGGCCGAGGTAGGAGG - Intronic
1079281411 11:19090185-19090207 CATTAAAAGTAGGAGGTAGAAGG + Intergenic
1079458718 11:20660831-20660853 GATTGAAAGGAGGAGGCAAGAGG - Intergenic
1079968594 11:27008196-27008218 CATGGAAAGGAAAGGGTAGAGGG + Intergenic
1080013052 11:27477400-27477422 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1081881204 11:46454270-46454292 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1081882189 11:46462995-46463017 CTTTGAAAGGCCAAGGTAGGTGG - Intronic
1081933833 11:46890835-46890857 CTTTGAAAGGACAAAGCAGGAGG - Intronic
1082135539 11:48545056-48545078 CATTCAAAGCAGTAGGTAGAGGG - Intergenic
1082150850 11:48736871-48736893 CATTCAAAGCAGAATGTAGAGGG + Intergenic
1082711192 11:56555546-56555568 CAGCGAAAGGAGAATGTATGAGG + Intergenic
1082779844 11:57278522-57278544 CTTTGGGAGGACAAGGTAGGAGG + Intergenic
1082813368 11:57492123-57492145 CTTTGAAAGGCAGAGGTAGGAGG + Intronic
1083025396 11:59546537-59546559 CTTTGGAAGGCTAAGGTAGGCGG + Intergenic
1083368171 11:62155720-62155742 CTTTGGGAGGACAAGGTAGGTGG - Intergenic
1083469494 11:62873568-62873590 CTTTGCAAGGCCAAGGTAGGAGG - Intronic
1083605804 11:63978155-63978177 CTTTGAAAGGCTGAGGTAGGAGG - Intronic
1084017219 11:66391718-66391740 CTTTGAGAGGACAAGGTGGGTGG + Intergenic
1084017898 11:66397440-66397462 CTTTGGAAGGACAAGGTGGGAGG - Intergenic
1084644601 11:70448145-70448167 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1084699114 11:70774913-70774935 CTTTGCAAGGACGAGGTAGGAGG + Intronic
1085195082 11:74665641-74665663 CTTTGAGAGGCCAAGGTAGGCGG - Intronic
1085287440 11:75372958-75372980 CATTGGAAGGCCAAGGCAGGTGG + Intergenic
1085594350 11:77794437-77794459 CTTTGCAAGGACAAGGTGGGAGG + Intronic
1086165206 11:83769860-83769882 CTTTCAAAGAACAAGGTAGGCGG - Intronic
1087070022 11:94069362-94069384 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087341294 11:96910907-96910929 CATTTAAAGCAGTAGGTAGAGGG + Intergenic
1087448168 11:98281891-98281913 CTTTGGGAGGACAAGGTAGGTGG + Intergenic
1087619686 11:100527435-100527457 TATTGAGAGGACAAGGCAGGTGG + Intergenic
1087636539 11:100708266-100708288 CTTTGAAAGGTCTAGGTAGGAGG + Intronic
1087718086 11:101632243-101632265 CATTGAGGGGAAAAGGTAAGAGG + Intronic
1087796156 11:102456304-102456326 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1088803501 11:113329482-113329504 CAATAAAATGAGAAGGAAGGAGG + Intronic
1088867256 11:113860566-113860588 CTTTGGAAGGTGAAGGCAGGCGG + Intronic
1089083931 11:115800844-115800866 CATTCACAGGAGAAGGCAGGGGG - Intergenic
1089435623 11:118463199-118463221 CTTTGGGAGGACAAGGTAGGAGG - Intronic
1089585108 11:119505570-119505592 CTTTGAAAGGACAAGGCGGGAGG + Intergenic
1089662467 11:119994335-119994357 TATTGCAAGGAGAAGGCAGCAGG + Intergenic
1089859951 11:121580846-121580868 CTTTGAGAGGACAAGGTAAGAGG - Intronic
1089939181 11:122397494-122397516 CTTTGAAAGGCCAAGGTTGGGGG + Intergenic
1090006144 11:123004022-123004044 TATTGAAAGTAAATGGTAGGAGG + Intergenic
1090418277 11:126555983-126556005 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1090914296 11:131149489-131149511 GATTAAAATGAAAAGGTAGGAGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1092179999 12:6440147-6440169 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1092771474 12:11900907-11900929 CATTGGAAGGCCAAGGCAGGTGG + Intergenic
1093450801 12:19311180-19311202 CTTTGGAAGGATAAGGTGGGAGG + Intronic
1093455578 12:19361925-19361947 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1093912820 12:24766621-24766643 CATTGGGAGGCCAAGGTAGGAGG - Intergenic
1094477273 12:30850881-30850903 CATTAAAAGGATAAGGTGGGAGG + Intergenic
1094619760 12:32068537-32068559 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1094639815 12:32262898-32262920 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1095044238 12:37482749-37482771 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1095240744 12:39856190-39856212 TATTGATAAGAGAAGGTAGATGG - Intronic
1095298685 12:40557056-40557078 CTTTGAAAGTAGAAAGTAGAAGG + Intronic
1095988119 12:48014110-48014132 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
1095994233 12:48065944-48065966 CTTTGAGAGGCCAAGGTAGGGGG - Intronic
1097240365 12:57571042-57571064 CATTGAAAGGCCAAGGCGGGAGG - Intronic
1097632165 12:62078001-62078023 CATTTAGGGGAGAATGTAGGAGG - Intronic
1097792372 12:63828590-63828612 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
1098034505 12:66288356-66288378 CAAGGAAATGAGAAGGTAGCTGG + Intergenic
1098049117 12:66434716-66434738 CTTTGAAGGTAGAAGGAAGGTGG - Intronic
1098343531 12:69475838-69475860 GAGTGAAAGGAGAATGTAGTTGG + Intronic
1098597040 12:72285760-72285782 CTTTGAGAGGCCAAGGTAGGCGG - Intronic
1098655170 12:73019164-73019186 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1098699705 12:73608670-73608692 CATTGAAAGCAGTATGTAGAGGG + Intergenic
1099079775 12:78162618-78162640 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1099916632 12:88903208-88903230 CATTGAGATTAGAAGGAAGGTGG + Intergenic
1100332908 12:93602337-93602359 CCTTGAAAGGCCAAGGCAGGAGG - Intergenic
1100547745 12:95619510-95619532 CATTGCAAGGCGGAGGCAGGTGG - Intergenic
1100630092 12:96379923-96379945 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1101015757 12:100498393-100498415 CATTGGAAGGCCAAGGCAGGCGG + Intronic
1101409900 12:104458744-104458766 AATTGCAAGGAGGAGGGAGGTGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101815485 12:108143055-108143077 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1102169140 12:110828891-110828913 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1102281019 12:111619004-111619026 CTTTGAGAGGCTAAGGTAGGAGG + Intergenic
1102331264 12:112033016-112033038 CATAGAAAGGAGGACGTATGGGG + Intronic
1102343086 12:112139092-112139114 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1102383544 12:112487375-112487397 CTTTGGAAGGACAAGGCAGGTGG - Intronic
1102401013 12:112629718-112629740 CATTGAAAGGCCCAGGTGGGAGG - Intronic
1102781781 12:115571769-115571791 CATTTAAACGAGGAGGTATGAGG - Intergenic
1102856540 12:116299338-116299360 CATAGAAAGGAGAAGTGTGGGGG + Intergenic
1103014162 12:117480951-117480973 CCTTGAAAGGCTGAGGTAGGAGG + Intronic
1103039618 12:117684458-117684480 CATGGAAATGAGCAGGGAGGGGG + Intronic
1103095414 12:118128253-118128275 CTTTGTAAGGCCAAGGTAGGAGG - Intronic
1103100572 12:118170872-118170894 CATTGAAATGAGAAGGAAAAAGG - Intronic
1103950231 12:124546654-124546676 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1103984712 12:124759600-124759622 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1104411118 12:128558693-128558715 CACTGAAAGGAAGAGGGAGGTGG - Intronic
1105292851 13:19063506-19063528 CTTTGATAGGACAAGGTGGGCGG + Intergenic
1105814107 13:24017738-24017760 GATTTAAAGGAGAAAGAAGGAGG - Intronic
1106154977 13:27146156-27146178 CTTTGGGAGGATAAGGTAGGTGG + Intronic
1106244952 13:27941151-27941173 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1106317839 13:28610797-28610819 CATTGAAAGCATAAGGGAGGGGG - Intergenic
1106444659 13:29816513-29816535 CTTTGGGAGGACAAGGTAGGAGG + Intronic
1106526664 13:30546726-30546748 CTTTGAAAGGCTGAGGTAGGAGG - Intronic
1106939974 13:34767628-34767650 CATTGGGAGGCCAAGGTAGGAGG + Intergenic
1107488336 13:40853966-40853988 CTTTGAAAGGCCGAGGTAGGTGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107952439 13:45475719-45475741 CTTTGGAAGGCTAAGGTAGGAGG + Intronic
1108010702 13:46005848-46005870 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1108207528 13:48106149-48106171 CTTTGAGAGGTGAAGGCAGGGGG - Intergenic
1108676886 13:52744792-52744814 CTTTGAAAGGCCAAGGGAGGAGG - Intergenic
1108726720 13:53191236-53191258 GATTAAAAGGAGAAGGAAAGAGG + Intergenic
1108904726 13:55453981-55454003 CTTTGGAAGGACAAGGTAGGTGG + Intergenic
1109061901 13:57631388-57631410 CATTTAAAGGAGGAGGGGGGAGG - Intergenic
1109986808 13:69996975-69996997 CTTTGGAAGGCAAAGGTAGGTGG + Intronic
1110236313 13:73221346-73221368 CAGTGAGAGGTGAAGCTAGGTGG - Intergenic
1111294915 13:86265768-86265790 CTTTGGAGGGACAAGGTAGGAGG - Intergenic
1111477606 13:88773312-88773334 CATTGAAAGGACCTGGTGGGAGG - Intergenic
1112038548 13:95520737-95520759 CATTGAAAGGCAGAGGCAGGTGG + Intronic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1112969570 13:105243645-105243667 TATTCACATGAGAAGGTAGGTGG - Intergenic
1113243577 13:108368169-108368191 GCTTGATAGGAGAAGGTGGGAGG + Intergenic
1113540639 13:111105639-111105661 CTCTGGAAGGACAAGGTAGGAGG + Intergenic
1114037407 14:18642954-18642976 CATTGAGAGGCCAAGGAAGGAGG - Intergenic
1114121230 14:19672089-19672111 CATTGAGAGGCCAAGGAAGGAGG + Intergenic
1114730098 14:24983988-24984010 CATTGAGAGGCCAAGGTGGGTGG + Intronic
1114853062 14:26403889-26403911 AATTGTAAGGAGAAGGTAAGTGG + Intergenic
1115593802 14:34889757-34889779 CCTTGGAAGGCCAAGGTAGGTGG + Intergenic
1115824360 14:37250302-37250324 CTTTGAGAGGCGAAGGCAGGTGG + Intronic
1115986440 14:39107176-39107198 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1116449663 14:45050494-45050516 CTTTGAGAGGACAAGGTAGGTGG - Intronic
1116810283 14:49533514-49533536 CAGTGAGAGGAAGAGGTAGGAGG - Intergenic
1117111762 14:52464551-52464573 CATTCAAAAGGGAAGGAAGGTGG + Intronic
1117131144 14:52687940-52687962 CTTTGAGAGGTGAAGGCAGGAGG + Intronic
1117161202 14:52992060-52992082 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1117333547 14:54737258-54737280 CATTCCAAGAAGAAGGTAGTGGG + Exonic
1117386660 14:55221069-55221091 CTTTGAAAGGTCAAGGTGGGCGG + Intergenic
1117496582 14:56311576-56311598 CATGGAACGGAGAAGGTATATGG + Intergenic
1118220044 14:63847199-63847221 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1118516712 14:66537934-66537956 ACTTGAGAGGATAAGGTAGGAGG - Intronic
1118571738 14:67201050-67201072 CTTTGAAAGGACAAGGCAGGAGG + Intronic
1118818454 14:69328930-69328952 CAAAGAGAGGAGAGGGTAGGAGG + Intronic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1119057649 14:71439343-71439365 CCTTGCAAGGAAAAGGTAGGTGG + Intronic
1119179809 14:72598127-72598149 CATTGTGGGGAGAAGTTAGGGGG + Intergenic
1119255649 14:73193898-73193920 CCTTGAGAGGCCAAGGTAGGAGG - Intronic
1120376879 14:83719613-83719635 CTTTGAAAGGCCAAGGCAGGCGG - Intergenic
1120438834 14:84511130-84511152 CTTTGAGAGGTGGAGGTAGGGGG + Intergenic
1120451229 14:84669104-84669126 CATTGCAGAGAAAAGGTAGGTGG - Intergenic
1120644442 14:87056679-87056701 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1120999992 14:90444663-90444685 CACAGAAAGGAGAAAGGAGGAGG - Intergenic
1121382233 14:93482788-93482810 GATGGAGAGCAGAAGGTAGGAGG - Intronic
1121506146 14:94479077-94479099 CATGGGAAGGAGAAAGTGGGAGG + Intronic
1121631595 14:95424994-95425016 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1121757510 14:96415209-96415231 CATTGGAAGGCTAAGGTGGGAGG + Intronic
1121898335 14:97669969-97669991 CTTTGAAAGGCCAAGGTTGGAGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122669407 14:103358769-103358791 CATTGGGAGGCTAAGGTAGGCGG - Intergenic
1122815814 14:104313112-104313134 CATTGAAGAGAGAAGATAGATGG + Intergenic
1122926364 14:104904710-104904732 CCTTCAAAGGAGGAGGGAGGAGG - Intergenic
1122952813 14:105055084-105055106 CTTTGGAAGGACAAGGCAGGTGG + Intronic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1123724460 15:23088257-23088279 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1124076417 15:26449500-26449522 CATTGGAAGGTGAAGCAAGGAGG - Intergenic
1124424969 15:29556008-29556030 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1124843582 15:33267837-33267859 CTTTGAAAGGCTAAGGCAGGTGG - Intergenic
1125251294 15:37707931-37707953 CATGAAAAGGGGAAGGAAGGAGG - Intergenic
1125472517 15:40018563-40018585 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1125550788 15:40542912-40542934 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1125586255 15:40822403-40822425 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1125837137 15:42762472-42762494 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1126768328 15:52031174-52031196 CATTGGGAGGACAAGGTGGGCGG - Intronic
1127036590 15:54925077-54925099 CATTGGGAGGACAAGGCAGGTGG - Intergenic
1127101745 15:55572927-55572949 CATTGGGAGGCCAAGGTAGGAGG + Intronic
1127195973 15:56586103-56586125 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1127441116 15:59009200-59009222 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
1127580190 15:60331354-60331376 CATTGAAAGACCAAGGTGGGAGG + Intergenic
1128099306 15:64985380-64985402 CATTCTAAGGAGAATGAAGGGGG + Intronic
1128254835 15:66188936-66188958 GATTGTAAGGCGAAGGTAGGAGG - Intronic
1128270212 15:66302718-66302740 GCTTGAAAGGAGAAGATGGGAGG - Intronic
1128285173 15:66430506-66430528 GAATGACAGGAGGAGGTAGGGGG - Intronic
1128472040 15:67962588-67962610 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1128858437 15:71042230-71042252 ACTTGGAAGGACAAGGTAGGAGG - Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129812106 15:78519514-78519536 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131863934 15:96686611-96686633 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1131954576 15:97718694-97718716 CTTTGAAAGGCCAAGGTAGGAGG - Intergenic
1132220825 15:100103817-100103839 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1132440255 15:101856369-101856391 CATTGGAAGGCTAAGATAGGAGG - Intergenic
1133186300 16:4101520-4101542 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1133301782 16:4787117-4787139 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1133307693 16:4821251-4821273 CATTGAATGGAAAAGGTGGGGGG - Intronic
1133339487 16:5027381-5027403 TATGGAAAGGAGATGGGAGGAGG + Intronic
1133363977 16:5196525-5196547 CTTTGAGAGGTGAAGGCAGGAGG + Intergenic
1133765137 16:8832637-8832659 AATTGAAGGGAGCAGTTAGGAGG - Intronic
1133893310 16:9902317-9902339 CATTGCAACTAGAAGGAAGGAGG - Intronic
1134009984 16:10844716-10844738 CTTTGAAAGGCGGAGGTGGGAGG - Intergenic
1134060058 16:11194027-11194049 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1134647068 16:15877521-15877543 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
1135123834 16:19789972-19789994 CTTTGGAGGGACAAGGTAGGAGG + Intronic
1135392325 16:22104242-22104264 CATTGAGAGGCCTAGGTAGGTGG + Intronic
1135411668 16:22239565-22239587 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1135659381 16:24281451-24281473 CTTTGGAAGGCTAAGGTAGGGGG - Intronic
1135941928 16:26829312-26829334 CTTTGAAAGGTCAAGGTGGGTGG + Intergenic
1136073481 16:27802896-27802918 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1136184539 16:28579028-28579050 CTTTGGGAGGCGAAGGTAGGAGG - Intronic
1136193431 16:28633124-28633146 CTTTGAGAGGCGAAGGCAGGTGG - Intergenic
1136989713 16:35144614-35144636 TAATGAGAGGAGAAGGTGGGAGG - Intergenic
1137366445 16:47863585-47863607 CTTGGAAATGAAAAGGTAGGTGG + Intergenic
1137420186 16:48326786-48326808 TATTGAAAGGGGAAGTAAGGAGG - Intronic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137630825 16:49943170-49943192 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1137876299 16:51999605-51999627 CATTTCAAGGAGAAGGAAGGGGG - Intergenic
1138191641 16:55018374-55018396 CATTGGAAGGCCAAGGTGGGCGG + Intergenic
1138365421 16:56472211-56472233 CTTTGGGAGGACAAGGTAGGAGG - Intronic
1138566887 16:57840092-57840114 CTTTGAGAGGCCAAGGTAGGCGG + Intronic
1138572899 16:57887127-57887149 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1138913042 16:61426352-61426374 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1139214567 16:65114638-65114660 CATTGCAAGGTGCAGGCAGGAGG + Intronic
1139479916 16:67224871-67224893 CATTGAAAGGGGAATTTGGGAGG - Intronic
1139571977 16:67818620-67818642 CTTTGGGAGGACAAGGTAGGAGG + Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140008086 16:71099756-71099778 CTTTGAGAGGACAAGGTAGGAGG + Intronic
1140021071 16:71239457-71239479 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1140105650 16:71957552-71957574 CTTTGGGAGGAGAAGGTGGGAGG + Intronic
1140122082 16:72092631-72092653 GATCGAAAGGAGAAAGTAAGGGG + Intronic
1140879996 16:79189542-79189564 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1142791681 17:2271468-2271490 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1143451056 17:7036925-7036947 CTTTGGAAGGAGCAGGAAGGAGG - Intronic
1144588879 17:16506850-16506872 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1144814759 17:18026201-18026223 TATTGCAAGGACAAGGAAGGTGG - Intronic
1144956569 17:19021658-19021680 CATTGACAAGAGGAGGTGGGCGG + Exonic
1146093117 17:29902028-29902050 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1146140482 17:30363603-30363625 CTTTGAGAGGTGAAGGTAAGAGG + Intergenic
1146175333 17:30662619-30662641 CATTGGAAGGCCAAGGTGGGAGG - Intergenic
1146320894 17:31845524-31845546 CATGGAGAGGAGAATGAAGGAGG + Intergenic
1146348786 17:32078661-32078683 CATTGGAAGGCCAAGGTGGGAGG - Intergenic
1146355052 17:32126777-32126799 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1146499574 17:33352863-33352885 CATGGGAAAGAGAAGGTAAGGGG - Intronic
1146733045 17:35212288-35212310 CTTTGGAAGGTGGAGGTAGGAGG + Intergenic
1147020345 17:37526759-37526781 CCTTAGAAGGGGAAGGTAGGAGG - Intronic
1147020498 17:37528321-37528343 CCTTATAAGGGGAAGGTAGGAGG - Intronic
1147061510 17:37883138-37883160 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1147257256 17:39189119-39189141 CTTTGAAAGGCTAAGGTGGGTGG + Intronic
1147278190 17:39336530-39336552 TAATGAAAGTAGAAGGTTGGGGG + Intronic
1147532037 17:41288423-41288445 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1147674687 17:42196767-42196789 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
1148391254 17:47274885-47274907 CATTGGGAGGCCAAGGTAGGAGG - Intronic
1148803715 17:50252179-50252201 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1148948529 17:51287545-51287567 CATTGAAGGGAGGCGGGAGGAGG + Intronic
1149278002 17:55066465-55066487 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1149528355 17:57375820-57375842 GAATGAAAGGAGAAGGATGGGGG - Intronic
1149574066 17:57698683-57698705 CATTGATAGGAGATGGAAAGAGG - Intergenic
1149621565 17:58049225-58049247 CATTGAGAGGCCAAGGTGGGAGG + Intergenic
1149727240 17:58908681-58908703 CCTTGAAAGGCCAAGGTGGGCGG - Intronic
1150115273 17:62542348-62542370 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1150128675 17:62654343-62654365 CATTCCAAGGACAAGGAAGGCGG - Intronic
1150128746 17:62654894-62654916 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1150734263 17:67722932-67722954 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1150854301 17:68735804-68735826 CTTTGAGAGGACAAGGCAGGAGG + Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151634590 17:75336979-75337001 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1151744482 17:76004593-76004615 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1153002671 18:470179-470201 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
1153170823 18:2313996-2314018 CATTGAGAGGTGAAGGAGGGAGG + Intergenic
1153321853 18:3781069-3781091 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1153616163 18:6936270-6936292 CAGTCAAGGGAGGAGGTAGGAGG - Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155314384 18:24557186-24557208 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1156603715 18:38640634-38640656 AATTTAAAGGTGAAGGTAGAGGG + Intergenic
1156727131 18:40141963-40141985 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1157877149 18:51284531-51284553 CTTTGAAAAGTGAAGGCAGGCGG - Intergenic
1157977771 18:52344907-52344929 TATTTGAAGGAGAAGGTATGAGG - Intronic
1158160213 18:54473176-54473198 CATTGGGAGGCCAAGGTAGGAGG - Intergenic
1158312216 18:56171032-56171054 CAATGCAAGGAGACTGTAGGAGG - Intergenic
1158762860 18:60411115-60411137 TATTGAAGGGAGAAGGTGAGGGG + Intergenic
1158824743 18:61204311-61204333 CATTGAAAGGAACAGCTAAGAGG - Intergenic
1158988207 18:62841129-62841151 CTTTGAAAGGTCAAGGCAGGTGG - Intronic
1159649947 18:70966030-70966052 CTTTGAAAGGCCAAGGCAGGCGG - Intergenic
1159810720 18:73015428-73015450 CACTGAAAGGAGAAGCTAGCAGG - Intergenic
1159867102 18:73719035-73719057 CATTGGGAGGACAAGGCAGGAGG - Intergenic
1159972934 18:74676333-74676355 CTTTGGAAGGAGAAGGCAGGCGG - Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160078350 18:75699911-75699933 CTTTGGAAGGACAAGGCAGGTGG - Intergenic
1160135481 18:76267582-76267604 CTTTGCAAGGCCAAGGTAGGCGG + Intergenic
1160196981 18:76763780-76763802 CTTTGGAAGGAGGAGGCAGGAGG - Intergenic
1161180384 19:2876967-2876989 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
1162154248 19:8666005-8666027 GAATCAAAGGAGAAGGGAGGAGG - Intergenic
1162586602 19:11563175-11563197 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1162821984 19:13228794-13228816 CGCTGAAAGGAGAAGAAAGGGGG + Intronic
1163301324 19:16448598-16448620 CATTGGGAGGCCAAGGTAGGCGG + Intronic
1163330552 19:16634531-16634553 CTTTGAAAGGCTGAGGTAGGCGG + Intronic
1163356795 19:16818058-16818080 CTTTGAAAGGCCAAGGTAGAAGG + Intergenic
1163468015 19:17480619-17480641 CTTTGAAAGGTCAAGGTGGGAGG - Intronic
1163535770 19:17875517-17875539 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1163796136 19:19339067-19339089 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1163833822 19:19561487-19561509 CATTGAGAGGTCGAGGTAGGAGG - Intergenic
1163880559 19:19917757-19917779 CATTGAAAGGCCAAGGCGGGTGG - Intronic
1164420817 19:28090617-28090639 CATTCAAAGCAGAATGTAGAGGG + Intergenic
1164430151 19:28180442-28180464 CATTCAAAGCAGAATGTAGAGGG + Intergenic
1164484949 19:28647344-28647366 CTTTGTGAGGAGAAGGCAGGAGG - Intergenic
1164602568 19:29572716-29572738 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1164647293 19:29868686-29868708 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1164973562 19:32552947-32552969 CTTTGAGAGGTGAAGGTGGGAGG + Intergenic
1165071481 19:33257497-33257519 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1165156319 19:33790892-33790914 CTTTGGGAGGAGAAGGCAGGAGG + Intergenic
1165338150 19:35188059-35188081 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1165498982 19:36172459-36172481 CATTGAGGGGAAAAGGTGGGTGG - Intergenic
1165919206 19:39282918-39282940 CTTTGGAAGGACAAGGTGGGAGG - Intergenic
1166090938 19:40508441-40508463 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166400860 19:42478812-42478834 CTTTGGGAGGACAAGGTAGGCGG - Intergenic
1166551995 19:43671911-43671933 CTTTGGAAGGACAAGGCAGGTGG - Intergenic
1166767351 19:45259516-45259538 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1166814642 19:45535981-45536003 CGTTGAGAGGCCAAGGTAGGCGG + Intronic
1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG + Intronic
1167002573 19:46754847-46754869 CTTTGAGAGGACAAGGCAGGTGG - Intronic
1167176720 19:47869545-47869567 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1167329195 19:48844042-48844064 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1167329485 19:48846078-48846100 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167858172 19:52259808-52259830 CTTTGAGAGGTGGAGGTAGGTGG - Intergenic
1167877132 19:52423612-52423634 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1168143884 19:54408460-54408482 CAATGAAGGAAGAAGGAAGGAGG + Intergenic
1168390090 19:56000010-56000032 CATTGAAAAGAGTGGGGAGGTGG - Intronic
925630993 2:5893269-5893291 CATTTAAAGGAGCATGTAGAGGG - Intergenic
926416822 2:12657617-12657639 AAATGAAAGGAGAAGGGAAGGGG - Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927421692 2:22940038-22940060 AAATGAAAGGAGAAGATAGAGGG + Intergenic
927546462 2:23957993-23958015 CTTTGGGAGGAAAAGGTAGGAGG - Intronic
927601352 2:24444458-24444480 CATTGGGAGGCTAAGGTAGGAGG - Intergenic
927736873 2:25532001-25532023 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
928019554 2:27692054-27692076 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
928040022 2:27865655-27865677 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
928204431 2:29273867-29273889 CACTGAATGGAGAAGTTAGAAGG + Intronic
928766150 2:34648286-34648308 TACTAAAAGGAGAAGGAAGGAGG + Intergenic
928967113 2:36987823-36987845 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
929001109 2:37347598-37347620 CAAGGAAAGGAGAAAATAGGGGG - Intronic
929017422 2:37512728-37512750 CTTTGAAAGGCCAAGGTAGGTGG - Intergenic
929560405 2:42952974-42952996 CTCTGAGAGGAGAAGGGAGGAGG - Intergenic
929688429 2:44054681-44054703 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
929752671 2:44732195-44732217 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
929766908 2:44851741-44851763 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930154045 2:48087533-48087555 CTTTGAGAGGCCAAGGTAGGGGG - Intergenic
930214919 2:48684975-48684997 CTTTGAGAGGACAAGGCAGGAGG - Intronic
930267900 2:49221397-49221419 AATTGAAAGAAGATTGTAGGGGG - Intergenic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930822833 2:55664356-55664378 CCTTGGGAGGCGAAGGTAGGAGG + Intronic
931146820 2:59528273-59528295 CATTGAGAGGCCAAGGCAGGAGG - Intergenic
931330059 2:61271560-61271582 CTTTAAAAGGAGAAGAAAGGAGG + Intronic
931701478 2:64912798-64912820 CTTTGGGAGGAGAAGGCAGGTGG + Intergenic
931747799 2:65305769-65305791 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
931970985 2:67586146-67586168 CAATGAAGGGAGAAGGTAATGGG + Intergenic
932042174 2:68311528-68311550 CTTTGAGAGGACAAGGTGGGCGG + Intronic
932151210 2:69373371-69373393 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
932233991 2:70106503-70106525 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
932324196 2:70845167-70845189 CATTTAAAGCAGTATGTAGGGGG + Intergenic
933233578 2:79838334-79838356 CATGGAAGGAAGAATGTAGGAGG + Intronic
933674783 2:85045001-85045023 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
933742457 2:85545345-85545367 CTTTGAAAGGCTGAGGTAGGAGG + Exonic
933756643 2:85644664-85644686 CTTTGAGAGGTCAAGGTAGGAGG - Intronic
933828294 2:86184417-86184439 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
933951167 2:87331644-87331666 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
934474067 2:94581105-94581127 CATGGAAAGGACACGGGAGGAGG - Intergenic
934606861 2:95701968-95701990 TACTGAAAGGAGCAGGCAGGTGG - Intergenic
934692839 2:96374963-96374985 CTTTGAAAGGAAGAGGCAGGAGG + Intergenic
934766704 2:96883818-96883840 CATGGAAAGGAGAAAGCAAGAGG - Intronic
935100339 2:99988615-99988637 CTCTGAAAGGAGATTGTAGGAGG - Intronic
935296630 2:101655451-101655473 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
935296851 2:101657170-101657192 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
935314329 2:101816630-101816652 GAGCAAAAGGAGAAGGTAGGTGG - Intronic
935618641 2:105110236-105110258 AATTGAGAGGCCAAGGTAGGGGG - Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936600684 2:113890885-113890907 AGTCGAAAGGAGAAGGTGGGTGG - Intronic
936642957 2:114336070-114336092 CATTGAAAGCAGTATGTAGAGGG + Intergenic
936946899 2:117939289-117939311 CAATGAAAGGAGAATGTTGAAGG + Intronic
937794828 2:126004674-126004696 CTTCGAGAGGACAAGGTAGGAGG + Intergenic
938047262 2:128132948-128132970 CTTTGGAAGGACAAGGCAGGAGG - Intronic
938604960 2:132882947-132882969 CTTTGGAAGGACAAGGTGGGAGG + Intronic
938692663 2:133806627-133806649 TATTGCAAGGATAAGGAAGGTGG + Intergenic
938859843 2:135356925-135356947 CTTTGGAAGGCTAAGGTAGGTGG - Intronic
938861488 2:135374161-135374183 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
939169210 2:138674526-138674548 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
939226465 2:139370895-139370917 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
939306084 2:140414157-140414179 CTTTGAAAGGTAAAGGTGGGAGG - Intronic
939347362 2:140983232-140983254 CAATGAAAGGAAAGGGTAGAGGG - Intronic
939934258 2:148270630-148270652 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940249546 2:151659542-151659564 CTTTGGAAGGTGAAGGCAGGTGG - Intronic
940687856 2:156876441-156876463 TACTGAAAGGAGAAGGAAGAAGG - Intergenic
941014325 2:160337435-160337457 CATTGAAAGGAAAAAGTTGTTGG - Intronic
941287758 2:163635322-163635344 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
941812054 2:169765003-169765025 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
941861471 2:170285606-170285628 CTTTGAGAGGACAAGGGAGGCGG - Intronic
942012624 2:171777956-171777978 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
942049977 2:172130539-172130561 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
942715020 2:178882126-178882148 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
942763335 2:179426300-179426322 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
942771256 2:179524039-179524061 CTTTGAAAGGCTAAGGCAGGAGG - Intronic
943990203 2:194679539-194679561 GATAGAAAGGAGATGGTAGATGG + Intergenic
944294507 2:198047423-198047445 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
944561742 2:200946231-200946253 CTTTGAGAGGAAAAGGTAAGAGG - Intronic
944718911 2:202403439-202403461 CTTTGGAAGGAGAAGGCAGGAGG - Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945052307 2:205835750-205835772 CATTGAAAGGAAGAGAGAGGTGG - Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945637544 2:212374849-212374871 AATTGAAAGGGGAAAGTAAGAGG + Intronic
945728784 2:213507158-213507180 TAATGAAAGGAGAGGGTTGGGGG + Intronic
945961071 2:216135552-216135574 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
946244045 2:218375513-218375535 CTTTGAAAGGAAGAGGTAGGAGG + Intergenic
946349975 2:219143955-219143977 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
946563413 2:220938278-220938300 CATTGAAAACACAAGGTAAGAGG - Intergenic
946659468 2:221984305-221984327 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
946915460 2:224516046-224516068 GAATGAAAGGAGAAGGTTGGAGG - Intronic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
947784860 2:232807813-232807835 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
947888180 2:233592815-233592837 CCTTGAAAGGAGAAGGGATGGGG + Intergenic
947894409 2:233656045-233656067 CCTTGAAAGGAGAAGGGATGGGG + Intronic
948001419 2:234570906-234570928 CTTTGAGAGGAGAAGATAAGGGG + Intergenic
948214552 2:236219117-236219139 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
948415640 2:237801090-237801112 CTTTGAAAGGCTGAGGTAGGTGG + Intronic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948955848 2:241290365-241290387 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
1169297286 20:4411149-4411171 CATTGAGAGGCCAAGGCAGGCGG - Intergenic
1170120151 20:12902578-12902600 CATTGAAAGGTGGAGGAAGCAGG - Intergenic
1170228697 20:14021230-14021252 CTTTGGGAGGCGAAGGTAGGCGG - Intronic
1170295451 20:14819804-14819826 CATTGAAAGGACAATGTGGCTGG + Intronic
1170344870 20:15373644-15373666 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170948918 20:20916626-20916648 CTTTGAAAGGAAAAAGGAGGAGG + Intergenic
1170957696 20:20996411-20996433 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1171115513 20:22521801-22521823 CTTTGAGAGGACAAGGCAGGAGG + Intergenic
1171469382 20:25357765-25357787 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1172145922 20:32758348-32758370 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172397413 20:34618536-34618558 CTTTGAAAGGCAAAGGTGGGAGG + Intronic
1172726467 20:37046854-37046876 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1172744099 20:37193409-37193431 GATTGAAAGGAGGAGGTGTGTGG + Intronic
1172789110 20:37490265-37490287 CATTGAAATGAGTAGCTAGGAGG - Intergenic
1172948616 20:38707308-38707330 CTTTGAAAGGCCAAGGTGGGCGG - Intergenic
1173587065 20:44190725-44190747 CTTTGAGAGGCCAAGGTAGGCGG + Intergenic
1173929241 20:46804789-46804811 CATTGGGAGGCCAAGGTAGGCGG + Intergenic
1174026686 20:47582608-47582630 CTTTGAAAGGCTGAGGTAGGAGG - Intronic
1174216088 20:48917582-48917604 CTTTGGAAGGTGGAGGTAGGAGG + Intergenic
1174600603 20:51721375-51721397 CCTTGGAAGGCCAAGGTAGGTGG + Intronic
1174638206 20:52020113-52020135 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1175238303 20:57527329-57527351 CAAAGAAGGGAGAACGTAGGCGG + Intergenic
1176659593 21:9621968-9621990 GATTGACAGGAGAAGGTGGCAGG + Intergenic
1177048172 21:16198035-16198057 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1177169813 21:17642584-17642606 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1177715789 21:24838510-24838532 GATTGAATGGAGAAGGAAAGTGG + Intergenic
1178117383 21:29431414-29431436 CATGGAAAGGAGGGGGTAGAGGG - Intronic
1178136348 21:29631800-29631822 CATTGAAAGTAAAAGACAGGTGG - Intronic
1178291545 21:31372726-31372748 CATTGGAAGGCCAAGGCAGGAGG + Intronic
1178505544 21:33159817-33159839 CATTGCAAGCAGCAGGTGGGAGG + Intergenic
1178745980 21:35250754-35250776 CATTGAAAGGGGTAGAAAGGGGG - Intronic
1179085977 21:38218144-38218166 CTTTGAGAGGACAAGGAAGGAGG + Intronic
1180021567 21:45131695-45131717 GACTGAAAGGAGAAGTGAGGAGG + Intronic
1180461532 22:15570002-15570024 CATTGAGAGGCCAAGGAAGGAGG - Intergenic
1180517817 22:16164440-16164462 CTTTGGGAGGAGAAGGCAGGTGG - Intergenic
1180684382 22:17653745-17653767 CTTTGGAAGGACAAGGGAGGAGG - Intronic
1180741689 22:18057520-18057542 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1181063450 22:20293253-20293275 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1181859472 22:25806931-25806953 CAATGATTGTAGAAGGTAGGTGG - Intronic
1182029012 22:27142982-27143004 CTTTGGAAGGACAAGGTGGGTGG - Intergenic
1182597042 22:31429891-31429913 CTTTGGGAGGTGAAGGTAGGCGG - Intronic
1182602966 22:31481403-31481425 CATTGGGAGGACAAGGTGGGAGG - Intronic
1182844869 22:33422134-33422156 CTTTGAAAGTCGAAGGTTGGAGG - Intronic
1182858767 22:33540888-33540910 CTTTGAGAGGCGGAGGTAGGCGG + Intronic
1183035350 22:35136916-35136938 CATTGAGAGGTGAGGGCAGGTGG - Intergenic
1183199465 22:36375777-36375799 CATTGAGAGGCCAAGGTGGGAGG + Intronic
1183449336 22:37883051-37883073 CTTTGAGAGGCGAAGGTGGGCGG + Intronic
1183511729 22:38239365-38239387 CACTGAAATGAGAAGGAATGAGG + Intronic
1183562263 22:38584519-38584541 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1183701475 22:39453686-39453708 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1183813002 22:40273888-40273910 CTTTGGAAGGACAAGGCAGGAGG - Intronic
949164382 3:920594-920616 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
949173341 3:1029578-1029600 GAGGGAATGGAGAAGGTAGGGGG + Intergenic
949543849 3:5055280-5055302 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
949951259 3:9230625-9230647 CTTTGGAAGGATAAGGCAGGAGG + Intronic
950237893 3:11339628-11339650 CATTAACATGAGAAGGTAGCAGG + Intronic
950325720 3:12107965-12107987 CTTTGAAAGGTTGAGGTAGGAGG + Intronic
950987310 3:17388603-17388625 CTTTGAAAGGTCAAGGCAGGAGG + Intronic
951001078 3:17560372-17560394 CTTTGAAAGGACAAGTTGGGAGG + Intronic
951257962 3:20472445-20472467 CATTGAAAGGAAAACGTGAGTGG + Intergenic
951797470 3:26556566-26556588 CTTTGAGAGGACAAGGTGGGTGG + Intergenic
951844778 3:27073500-27073522 CCAGGAAAGGAGAAGGCAGGTGG + Intergenic
951884953 3:27515296-27515318 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
951888428 3:27547049-27547071 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
952175584 3:30859107-30859129 CTTTGAAGTGAGAATGTAGGAGG + Intronic
952226846 3:31386489-31386511 CATTGCCAGGAGATGGTATGAGG - Intergenic
952434894 3:33263408-33263430 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
952657691 3:35806385-35806407 AATTGAAAGGGGTTGGTAGGAGG - Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952753300 3:36843239-36843261 TATTGAAAGGAGGAGGTAGAGGG + Intronic
952810941 3:37402014-37402036 CAGTGAGAGGAGCAGGTTGGGGG - Intronic
953188063 3:40656507-40656529 ATTTGAAAGGAGAATGAAGGAGG - Intergenic
953650499 3:44798645-44798667 CTTTGAAAGGATGAGGCAGGAGG - Intronic
953719148 3:45340162-45340184 CATTGAAAATAGAAGGAAGTTGG - Intergenic
954008986 3:47618296-47618318 CCTTGGGAGGAGAAGGTAGGAGG + Intronic
954288373 3:49635729-49635751 CTTTGAGAGGCGAAGGTGGGAGG + Intronic
954347048 3:50008792-50008814 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
954732243 3:52674236-52674258 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
954837528 3:53482739-53482761 CTTTGAGAGGACAAGGTGGGAGG + Intergenic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955066005 3:55534173-55534195 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
955998661 3:64705089-64705111 CTTTGGAAGGCCAAGGTAGGCGG + Intergenic
956398555 3:68851733-68851755 CATTGAAAGGTTATAGTAGGCGG + Intronic
957248161 3:77738655-77738677 CATTGGGAGGACAAGGTGGGAGG - Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957577002 3:82021091-82021113 CAATGAAAGGAGAACCTAGTTGG - Intergenic
958176205 3:89998949-89998971 CATTCAAAGGAGTATGTAGAGGG + Intergenic
958792175 3:98664402-98664424 CTTTGAGAGGCGAAGGCAGGTGG - Intergenic
959818348 3:110702898-110702920 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
959936130 3:112031324-112031346 CTTTGAAAGGCCAAGGGAGGAGG - Intergenic
959951401 3:112184392-112184414 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
960108444 3:113822297-113822319 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
960237581 3:115301642-115301664 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
960671876 3:120162335-120162357 CCTTGGAAGGACAAGGCAGGAGG - Intergenic
961021637 3:123512486-123512508 CATGGAAAGGTGAGGGAAGGTGG + Intronic
961796158 3:129410559-129410581 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
961972742 3:130987572-130987594 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
962470966 3:135708286-135708308 CTTTGAAAGGCCGAGGTAGGAGG - Intergenic
962635262 3:137324928-137324950 CACTGAGAGGAAAAGGTGGGAGG - Intergenic
962654077 3:137524830-137524852 AATTGATAGAAGAAGGGAGGGGG + Intergenic
962767800 3:138581458-138581480 CTTTGAGAGGTGAAGGTGGGTGG + Intronic
962778482 3:138687696-138687718 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
962779848 3:138702316-138702338 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
963453189 3:145510815-145510837 CATTGAAATGAAAAGTTAGTTGG + Intergenic
963461646 3:145621727-145621749 CTTTGAGAGGTCAAGGTAGGTGG + Intergenic
964234364 3:154507529-154507551 CTTTGAGAGGTGAAGGTGGGAGG - Intergenic
964572582 3:158125060-158125082 CTTTGGAAGGATAAGGTGGGAGG - Intronic
964598408 3:158465497-158465519 AGTTGAAAGGAGAAGTTAGCAGG + Intronic
964656931 3:159077707-159077729 CATTGAAAGTAGAATGTATGTGG + Intronic
964824858 3:160814160-160814182 CAATGAAATGAGATGTTAGGTGG - Intronic
965537858 3:169842592-169842614 CTTTGAGAGGACAAGGCAGGTGG - Intronic
966058455 3:175726677-175726699 CATTGAGAGGTGAGGGTAGTAGG - Intronic
966090905 3:176134831-176134853 TAAAGAAGGGAGAAGGTAGGGGG - Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966314508 3:178630684-178630706 CAAGAAAAGGAGAAGGGAGGAGG - Intronic
966401718 3:179554269-179554291 CATTGGAAGGCGGAGGCAGGTGG + Intergenic
966409994 3:179637895-179637917 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
966519092 3:180854070-180854092 CTTTGGAAGGCGAAGGCAGGAGG + Intronic
967309564 3:188093363-188093385 CTTTGAGAGGCGGAGGTAGGAGG - Intergenic
967335988 3:188345319-188345341 CACGGAAAGCAGAAGGTAGCCGG - Intronic
967585895 3:191214767-191214789 CATTGGGAGGCCAAGGTAGGTGG + Intronic
967835171 3:193956270-193956292 CATTGCAGGGAAAAGGTAAGTGG - Intergenic
967887678 3:194344451-194344473 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
968076018 3:195816496-195816518 CCTTGTAAGGAGAAGGGCGGAGG - Intergenic
968266112 3:197364646-197364668 CATTGAAAGGCTGAGGCAGGAGG - Intergenic
969815714 4:9685907-9685929 CTTTGGGAGGACAAGGTAGGAGG + Intergenic
969935479 4:10675798-10675820 GAATGAATCGAGAAGGTAGGAGG + Intronic
970351456 4:15205861-15205883 CATTGAAAGGAGAAGTTTGGGGG - Intergenic
970730195 4:19094077-19094099 CATTGAAAGGAAATATTAGGGGG + Intergenic
971331690 4:25686709-25686731 CATTGAGAGGTCAAGGCAGGCGG - Intergenic
971412597 4:26390809-26390831 CATTGAAAGGCCAAGGTGTGAGG + Intronic
971570639 4:28206300-28206322 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
972287315 4:37661521-37661543 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
972323588 4:37994485-37994507 CTTTGGGAGGACAAGGTAGGTGG - Intronic
972961997 4:44464367-44464389 CATTGAAGGGAGAAGACAAGGGG - Intergenic
973341935 4:49014207-49014229 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
973778526 4:54266488-54266510 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
974008409 4:56584208-56584230 CCTTGAAAGGTGGAGGTGGGAGG - Intronic
974422380 4:61694278-61694300 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
975069699 4:70118769-70118791 TGTTGAAAGGCCAAGGTAGGAGG - Intergenic
975157815 4:71091189-71091211 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
975174876 4:71276802-71276824 CTTTGAGAGGTGGAGGTAGGTGG + Intronic
975552144 4:75624306-75624328 CTTTGAAAGGCCGAGGTAGGAGG + Intronic
975705139 4:77104324-77104346 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
976192890 4:82505288-82505310 CTTTGGAAGGTCAAGGTAGGAGG - Intronic
976292411 4:83433738-83433760 CTTTGGAAGGCGAAGGCAGGAGG + Intronic
976627713 4:87205161-87205183 CTTTGAGAGGACAAGCTAGGAGG + Intronic
976934772 4:90616435-90616457 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
977179503 4:93856913-93856935 CATTGGGAGGAGAAGGTAGGTGG + Intergenic
978644656 4:110915601-110915623 CATGGAAGGGAGATGGTAGCCGG + Intergenic
978907391 4:114023358-114023380 CACTGAAAGTAACAGGTAGGTGG - Intergenic
979801907 4:124920234-124920256 CATGGAATGAATAAGGTAGGAGG + Intergenic
980030463 4:127823390-127823412 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
980147950 4:129013136-129013158 ACTTGAAAGGAGAGGGTGGGAGG - Intronic
980473842 4:133284420-133284442 CGTTGAGGGTAGAAGGTAGGAGG - Intergenic
980597211 4:134970003-134970025 CATTTAAAGCAGAATGTAGAGGG + Intergenic
980631572 4:135442910-135442932 CTTTGGAAGGACAAGGTGGGCGG + Intergenic
980785815 4:137553333-137553355 CCTTGGAAGGAGGAGGCAGGCGG + Intergenic
980946610 4:139327178-139327200 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
981438279 4:144751861-144751883 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981909999 4:149967997-149968019 AATTGAGAGGAGAAGGAAAGGGG - Intergenic
982002570 4:151034376-151034398 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
982436747 4:155389019-155389041 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
982524805 4:156465424-156465446 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
982950469 4:161688324-161688346 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
983466849 4:168104852-168104874 CAATGCAAGCAGGAGGTAGGAGG - Intronic
984022220 4:174499488-174499510 CATTGAAAAGAGAAACAAGGTGG - Intronic
984239088 4:177195794-177195816 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
984572940 4:181415007-181415029 AATTGAATGTACAAGGTAGGAGG - Intergenic
985113486 4:186569444-186569466 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
985263031 4:188132529-188132551 CTTTGGAAGGTCAAGGTAGGAGG - Intergenic
985285690 4:188334492-188334514 CATTCCAAGGAGAAAGTAGGAGG - Intergenic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985811036 5:2085715-2085737 CCTTGGAAGGCCAAGGTAGGGGG + Intergenic
986428671 5:7660028-7660050 GCTTGAGAGGAGAAGGTGGGAGG + Intronic
987397378 5:17437556-17437578 AATGGAAAGGACAAGGAAGGAGG + Intergenic
988279137 5:29122841-29122863 CATTGACAGGCCAAGGTGGGAGG - Intergenic
988458629 5:31411868-31411890 CTTTGAAAGGTCAAGGTGGGTGG - Intronic
988526549 5:31992182-31992204 AATTGAAAGTAGGAGATAGGAGG - Intronic
988719068 5:33858411-33858433 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988863810 5:35312866-35312888 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
988924562 5:35976594-35976616 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988928201 5:36010206-36010228 CATTGAGAGGCCAAGGCAGGTGG + Intergenic
989060702 5:37408479-37408501 AATTGAAAAAAGAAGGTAGAGGG + Intronic
989063427 5:37433302-37433324 CTTTGTAAGGCCAAGGTAGGCGG - Intronic
989263049 5:39440539-39440561 AATTGAAAGGAGATTGTATGTGG - Intronic
989392332 5:40914070-40914092 CTTTGAGAGGACAAGGCAGGAGG - Intronic
989487884 5:42013059-42013081 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
989810982 5:45674830-45674852 CTTTGGAAGGCTAAGGTAGGAGG + Intronic
990102051 5:52202728-52202750 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
990436651 5:55799304-55799326 CTTTGGAAGGACAAGGTGGGAGG - Intronic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991354442 5:65753403-65753425 CATTGGAAGGCCAAGGTGGGCGG + Intronic
991396861 5:66213198-66213220 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
991588963 5:68229112-68229134 GATTGAAAGGAGAGTGTTGGGGG + Intronic
992564046 5:77980585-77980607 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
992592435 5:78309253-78309275 CTTTGGGAGGCGAAGGTAGGTGG + Intergenic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
992981811 5:82182986-82183008 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
993194232 5:84720380-84720402 CATTTGAGGGGGAAGGTAGGAGG + Intergenic
993307014 5:86286493-86286515 CACTGAAACTAGAATGTAGGAGG - Intergenic
993654864 5:90564989-90565011 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
993798486 5:92300120-92300142 CATTGAAAGCAGTATGTAGAGGG - Intergenic
993991995 5:94668721-94668743 CTTTGGGAGGACAAGGTAGGAGG - Intronic
994469122 5:100179825-100179847 CCTTGAAAGAAGAGGGTTGGAGG + Intergenic
994629929 5:102272710-102272732 CTTTGGAAGGACAAGGTGGGTGG + Intronic
995667355 5:114557661-114557683 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
996292859 5:121874636-121874658 CTTTGGAAGGCCAAGGTAGGGGG + Intergenic
996505092 5:124259624-124259646 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
997161812 5:131616848-131616870 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997333863 5:133089768-133089790 CTTTGAAAGGCTAAGGTGGGAGG + Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997903759 5:137793876-137793898 CTTTGGGAGGACAAGGTAGGAGG - Intergenic
997937966 5:138130985-138131007 CTTTGAGAGGACAAGGCAGGTGG + Intronic
997946967 5:138211416-138211438 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
998151772 5:139761646-139761668 CATGGAAAGCAGAGGTTAGGGGG - Intergenic
998712455 5:144842415-144842437 CTTTGAGAGGACAAGGTGGGCGG - Intergenic
998841195 5:146256097-146256119 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
1000336733 5:160246838-160246860 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
1000819322 5:165964376-165964398 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1001592457 5:172874813-172874835 CCTTGAAAGGCCAAGGTGGGAGG + Intronic
1001840279 5:174870411-174870433 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1001867318 5:175116842-175116864 CATTTGAGGGAGGAGGTAGGTGG + Intergenic
1002511442 5:179721331-179721353 CTTCGAAAGGCGAAGGCAGGTGG - Intronic
1002549604 5:179977478-179977500 CTTTGAGAGGACAAGGCAGGAGG + Intronic
1003055594 6:2816080-2816102 CTTTGAGAGGTGGAGGTAGGAGG - Intergenic
1003595351 6:7469534-7469556 CTTTGGGAGGAGAAGGCAGGAGG - Intergenic
1003626401 6:7745512-7745534 CCTTGGAAAGACAAGGTAGGAGG - Intronic
1003699130 6:8442813-8442835 TATTGAAAGGAAAAGAAAGGAGG - Intergenic
1003722743 6:8722884-8722906 CTTTGAGAGGCTAAGGTAGGAGG + Intergenic
1003807352 6:9740298-9740320 AATTAAAAGGGGAAGGAAGGAGG + Intronic
1004102782 6:12631617-12631639 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1004300356 6:14452152-14452174 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1004962085 6:20801165-20801187 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1005148677 6:22722439-22722461 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1005425311 6:25696888-25696910 CTTTGAAAAGAGAGGATAGGTGG + Intronic
1006018344 6:31101387-31101409 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
1006173320 6:32107837-32107859 CAATGAGAGGTGAAGGTAGAAGG + Intronic
1006220512 6:32485590-32485612 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
1006447911 6:34090299-34090321 CATTAAACAGAAAAGGTAGGAGG + Intronic
1006810843 6:36819690-36819712 CAAGGAAAGGGGAAGGGAGGGGG - Intronic
1007741005 6:44009516-44009538 CATGGAAAGAAGAAGGAAAGAGG + Intergenic
1008185027 6:48378092-48378114 CATAGAGAGGACAAGGGAGGAGG - Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008772461 6:54995356-54995378 CTTTGAAAGGCTAAGGCAGGTGG + Intergenic
1008937052 6:57003255-57003277 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1009284431 6:61798014-61798036 ACTTGAGAGGAGAAGGTGGGAGG - Intronic
1009355510 6:62739882-62739904 CATTGAAAGTAGATGGAGGGAGG + Intergenic
1009410043 6:63355920-63355942 CATTGGAAGGTCAAGGTGGGTGG - Intergenic
1009421543 6:63469957-63469979 CTTTGGGAGGCGAAGGTAGGTGG - Intergenic
1009422337 6:63477775-63477797 CTTTGAAAGGCCAAGGAAGGAGG - Intergenic
1009679434 6:66872906-66872928 CATTTAAAGCAGTAGGTAGAAGG - Intergenic
1009934191 6:70214044-70214066 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1011133948 6:84079753-84079775 TATTGAAAGGAAAAGTGAGGAGG + Intronic
1011219018 6:85034655-85034677 CAGGGAAAGGATATGGTAGGTGG - Intergenic
1011825724 6:91303299-91303321 CATTGAGAGGTGAAGCTAGGTGG - Intergenic
1011928413 6:92677035-92677057 TATTGGAAGGTGGAGGTAGGAGG + Intergenic
1012268687 6:97180342-97180364 CCTTGGAAGGACAAGGCAGGCGG - Intronic
1012959790 6:105610182-105610204 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1013091641 6:106905725-106905747 CATTGAGAAGCCAAGGTAGGCGG + Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013439454 6:110147988-110148010 CTTTGAAAGGCTAAGGCAGGAGG - Intronic
1014028407 6:116674465-116674487 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1014457239 6:121650066-121650088 AATTGAAAGCAGAAAGTAGATGG + Intergenic
1015017745 6:128434774-128434796 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1015183358 6:130384553-130384575 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1015555228 6:134454190-134454212 CATTGTGTGGAGAAGGTTGGAGG - Intergenic
1015558761 6:134492123-134492145 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1015762001 6:136672744-136672766 CTTTGGGAGGACAAGGTAGGCGG + Intronic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1016076105 6:139797403-139797425 CTTTGAAAGGCCAAGGTAGGTGG - Intergenic
1016214175 6:141575531-141575553 CATTGAAAAGTGATAGTAGGAGG + Intergenic
1016917998 6:149263046-149263068 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1017551626 6:155515756-155515778 CTTTGAGAGGCGAAGGCAGGTGG - Intergenic
1017809722 6:157976284-157976306 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1018379147 6:163241707-163241729 TTTTGAATGGAGAAGGTAGGAGG + Intronic
1018702631 6:166439349-166439371 CATTGAAAGGCCAAGGCAGTTGG - Intronic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1019923464 7:4177521-4177543 CATTGAAAATAGAATGTAGAAGG - Intronic
1020022266 7:4876230-4876252 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1020032922 7:4945507-4945529 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020322039 7:6946297-6946319 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1020566211 7:9798933-9798955 CTTTGAAAGGCTAAGGCAGGAGG + Intergenic
1020729900 7:11867597-11867619 CATTGGGAGGCCAAGGTAGGTGG + Intergenic
1020793307 7:12652858-12652880 CTTTGAGAGGATGAGGTAGGCGG + Exonic
1020948223 7:14643205-14643227 CATTGCAGGAAAAAGGTAGGTGG + Intronic
1021519544 7:21525590-21525612 CTTTGAGAGGACAAGGCAGGTGG - Intergenic
1021568341 7:22037202-22037224 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
1021980334 7:26048081-26048103 CATTGGGAGGCCAAGGTAGGTGG - Intergenic
1023217419 7:37878794-37878816 TGTTGATAGGAGAAGGTGGGAGG - Intronic
1023393950 7:39734996-39735018 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
1023437781 7:40156218-40156240 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
1023573538 7:41599127-41599149 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1023593986 7:41809704-41809726 CATTGACAGGAGAGGAGAGGTGG + Intergenic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1023882462 7:44328069-44328091 GCTTGAAAGGACAAGGTGGGAGG - Intronic
1023979418 7:45058986-45059008 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1024080532 7:45851892-45851914 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1024605758 7:51021437-51021459 CCTTGGGAGGTGAAGGTAGGAGG - Intronic
1024620197 7:51150421-51150443 CACTGAATGGAGAAGGTTGCTGG - Intronic
1024683876 7:51723705-51723727 CAATGAAAGGAAAGGGAAGGGGG - Intergenic
1024749906 7:52453320-52453342 TATTGAAACGAGAAAGTAGTTGG - Intergenic
1025064770 7:55843889-55843911 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1025186228 7:56861675-56861697 CATTGAAAGGCCAAGGCGGGTGG + Intergenic
1025290163 7:57712296-57712318 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1025685694 7:63715234-63715256 CATTGAAAGGCCAAGGCGGGTGG - Intergenic
1025888016 7:65617057-65617079 CATTTAAAAAAGAAGGGAGGGGG - Intergenic
1025934250 7:66021952-66021974 CTTTGAAAGGCTAAGGTGGGTGG + Intergenic
1025995827 7:66526810-66526832 CTTTGGGAGGACAAGGTAGGAGG + Intergenic
1026086864 7:67269916-67269938 CTTTGAAAGGCTGAGGTAGGAGG - Intergenic
1026277366 7:68891792-68891814 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
1026303716 7:69122019-69122041 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1026329833 7:69342248-69342270 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1026367748 7:69666656-69666678 CTTTGAGAGGTGAAGGCAGGAGG + Intronic
1026454580 7:70559575-70559597 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026915427 7:74117259-74117281 CTTTGAAAGGTCAAGGCAGGAGG - Intronic
1026961762 7:74412828-74412850 CTTTGAGAGGACAAGGTGGGAGG + Intergenic
1027560638 7:79724511-79724533 AAGGGAAAGGAGAAGGTAAGTGG + Intergenic
1027785351 7:82573449-82573471 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1027887589 7:83929343-83929365 TATTATAAGTAGAAGGTAGGTGG - Intergenic
1027969317 7:85058060-85058082 CTTTGAAAGGAAAAGAAAGGAGG + Intronic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028299923 7:89185615-89185637 CTTTGAAAGGACGAGGCAGGTGG + Intronic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1028465592 7:91148129-91148151 CTTTGAGAGGATAAGGCAGGAGG + Intronic
1029806259 7:103000267-103000289 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1030716072 7:112808489-112808511 CATTGGAAGGCCAAGGTGGGAGG - Intergenic
1030796282 7:113791865-113791887 CATTTAATGGAGAAGTTGGGAGG - Intergenic
1031552685 7:123134134-123134156 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1031756381 7:125648442-125648464 CATTGAGAGGCCAAGGTGGGTGG - Intergenic
1031760042 7:125702417-125702439 ACTTGGAAGGTGAAGGTAGGAGG - Intergenic
1032056571 7:128689168-128689190 CTTTGGAAGGCCAAGGTAGGCGG - Intergenic
1032130340 7:129222802-129222824 CCTGGCAAGGAGAAGGAAGGAGG - Intergenic
1032180079 7:129668006-129668028 CTTTGGAAGGACAAGGCAGGAGG - Intronic
1032229903 7:130065459-130065481 CTTTGGAAGGACAAGGCAGGTGG - Intergenic
1033115016 7:138617603-138617625 CTTTGAAAGGCCAAGGTAGGAGG + Intronic
1033115216 7:138619162-138619184 CTTTGGAAGGACAAGGCAGGAGG + Intronic
1033454967 7:141494658-141494680 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034087451 7:148333182-148333204 CTTTGGGAGGACAAGGTAGGTGG + Intronic
1034095902 7:148407458-148407480 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034247572 7:149659542-149659564 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1034426355 7:151016239-151016261 CATGGAAAGGAGGAGGAATGAGG + Intronic
1034616202 7:152418948-152418970 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1035412099 7:158653123-158653145 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
1035905025 8:3500065-3500087 GATTGTAGGGAGAAGGTAAGTGG - Intronic
1036125496 8:6058126-6058148 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1036393685 8:8348158-8348180 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1037095694 8:14983586-14983608 CCTTGAGAGGCCAAGGTAGGAGG - Intronic
1037282920 8:17263698-17263720 CATTGGAAGGCCAAGGCAGGTGG + Intronic
1037311686 8:17562895-17562917 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1037825653 8:22159168-22159190 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038312699 8:26456735-26456757 CTTTGGGAGGCGAAGGTAGGTGG + Intronic
1038843319 8:31206061-31206083 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1038995297 8:32916419-32916441 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1039329158 8:36517608-36517630 TATTGAAGGGAGAAGGCAGATGG + Intergenic
1039331705 8:36544497-36544519 CTTTGGAAGGCCAAGGTAGGGGG + Intergenic
1039639006 8:39198619-39198641 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1039670997 8:39598522-39598544 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1039921337 8:41896347-41896369 GACCGAAAGAAGAAGGTAGGAGG - Exonic
1040074779 8:43218547-43218569 CTTTGAAAGGCCAAGGTAGGTGG - Intergenic
1040076177 8:43233607-43233629 CAATGGAAAAAGAAGGTAGGAGG + Intergenic
1041935783 8:63330400-63330422 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1042215455 8:66426501-66426523 CTTTGAAAGGCCAAGGTAGGTGG + Intergenic
1042346932 8:67737036-67737058 CATTGAAAAGGGAAGATTGGAGG - Intronic
1042487341 8:69361174-69361196 TATTCAAGGGAGAAGGGAGGAGG - Intergenic
1042599844 8:70488202-70488224 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
1043263855 8:78237575-78237597 TTTTGAAAGGAGAAGGCAGGAGG + Intergenic
1043409384 8:79976459-79976481 CATTGAGAGGCCAAGGTAGACGG + Intronic
1043990017 8:86741418-86741440 CTTTGCAAGGACAAGGTGGGCGG + Intronic
1044103295 8:88168949-88168971 CCTTGAAAGGCAAAGGTGGGAGG - Intronic
1044241028 8:89888832-89888854 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1044563867 8:93641550-93641572 CATTGAGAGGCCAAGGCAGGCGG + Intergenic
1044575312 8:93762438-93762460 CATTGAGAGGTCAAGGCAGGAGG - Intronic
1044687439 8:94840798-94840820 CTTTGGAAGGCCAAGGTAGGTGG - Intronic
1044935111 8:97286497-97286519 CTTTGAGAGGTCAAGGTAGGTGG - Intergenic
1044962585 8:97545379-97545401 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1044980756 8:97714367-97714389 CATTGGAAGGCTAAGGCAGGAGG + Intronic
1044984894 8:97748611-97748633 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
1045179314 8:99762892-99762914 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1046398352 8:113671253-113671275 CTTTGAAAGATGAAGGAAGGAGG - Intergenic
1046886719 8:119375676-119375698 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1047270975 8:123358587-123358609 CTTTGAGAGGTCAAGGTAGGTGG - Intronic
1047412376 8:124634389-124634411 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1048737343 8:137516232-137516254 CATTGGAAGGCCAAGGTGGGTGG - Intergenic
1048875766 8:138836025-138836047 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
1048893839 8:138970923-138970945 CATTGACTGGTCAAGGTAGGGGG + Intergenic
1049120374 8:140731649-140731671 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1049764382 8:144347081-144347103 CTTTGACAGGACAAGGCAGGAGG - Intergenic
1050186555 9:2981174-2981196 CATTAAAAGGGTAAGGTAGGAGG + Intergenic
1050186626 9:2981767-2981789 AACTAAAAGAAGAAGGTAGGTGG + Intergenic
1050315737 9:4398928-4398950 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1050325547 9:4493657-4493679 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1050848759 9:10257975-10257997 GAAGGGAAGGAGAAGGTAGGTGG + Intronic
1050931712 9:11336779-11336801 CTTTGACAGGCCAAGGTAGGAGG - Intergenic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1052029691 9:23614356-23614378 CTTTGAAAGGCCAAGGTGGGGGG + Intergenic
1052839180 9:33276949-33276971 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
1053028211 9:34749487-34749509 CCTTGAAAGGCCAAGGTGGGAGG + Intergenic
1053030642 9:34774526-34774548 CTTTGGAAGGCGGAGGTAGGTGG + Intergenic
1053107649 9:35425719-35425741 CATTGAGAGGCCAAGGTGGGAGG - Intergenic
1053684010 9:40505027-40505049 CATGGAAAGGACATGGGAGGAGG + Intergenic
1053908276 9:42868156-42868178 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1053933984 9:43133312-43133334 CATGGAAAGGACACGGGAGGAGG + Intergenic
1054150045 9:61595073-61595095 CTTTGGAAGGACAAGGCAGGAGG + Intergenic
1054279711 9:63119926-63119948 CATGGAAAGGACACGGGAGGAGG - Intergenic
1054297105 9:63340491-63340513 CATGGAAAGGACACGGGAGGAGG + Intergenic
1054395125 9:64644999-64645021 CATGGAAAGGACATGGGAGGAGG + Intergenic
1054429772 9:65150199-65150221 CATGGAAAGGACATGGGAGGAGG + Intergenic
1054469809 9:65526175-65526197 CTTTGGAAGGACAAGGCAGGAGG + Intergenic
1054500611 9:65871333-65871355 CATGGAAAGGACACGGGAGGAGG - Intergenic
1055560315 9:77515718-77515740 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1055913946 9:81380955-81380977 CATGGAACAGAGAAGGAAGGCGG + Intergenic
1055956484 9:81778468-81778490 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1056442460 9:86634510-86634532 CCTTGAAATGAGAAGGTTTGGGG - Intergenic
1056448335 9:86688536-86688558 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1056874152 9:90311917-90311939 CATAGAAATGAGAAGGTTGTGGG - Intergenic
1056989888 9:91400885-91400907 CTTTGAAAGGACAAGGCAGAAGG - Intergenic
1057100918 9:92359190-92359212 CTTTGAAAGGCCAAGGCAGGCGG - Intronic
1057289421 9:93792683-93792705 CTTTGAGAGGTCAAGGTAGGAGG - Intergenic
1057339436 9:94186181-94186203 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1057393926 9:94662664-94662686 CATTTAAAGGCTAAGGCAGGAGG - Intergenic
1057611232 9:96545559-96545581 CTTTGGAAGGCCAAGGTAGGTGG - Intronic
1057688881 9:97264990-97265012 CATTGAGAGGCCAAGGTGGGAGG + Intergenic
1057883852 9:98813741-98813763 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1058585749 9:106504594-106504616 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1058759120 9:108112841-108112863 CTTTGGAAGGCCAAGGTAGGGGG - Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059275431 9:113092702-113092724 CTTTTAAAGGACAAGGTGGGTGG + Intergenic
1059912966 9:119066569-119066591 CATTCAAAGGAGTGGGTAGAGGG - Intergenic
1060119769 9:120977661-120977683 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1060340470 9:122771147-122771169 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1060725670 9:126004093-126004115 CTTTGAGAGGCTAAGGTAGGAGG - Intergenic
1060816952 9:126640080-126640102 TATAGAAAGAAGAAGGGAGGAGG + Intronic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1062177485 9:135171968-135171990 TAATGAAAGGAGAGGGTATGGGG - Intergenic
1062304130 9:135892923-135892945 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1203637152 Un_KI270750v1:123811-123833 GATTGACAGGAGAAGGTGGCAGG + Intergenic
1185449515 X:275082-275104 CAGTGAAGGGAGGAGGGAGGAGG + Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186856796 X:13634758-13634780 CTTTGGGAGGAGGAGGTAGGTGG + Intergenic
1188253994 X:27936734-27936756 CATTTAAAAGATAAGGTAGGCGG - Intergenic
1188825105 X:34821914-34821936 CATTGACAGCAGAAGTTAGAAGG + Intergenic
1189125588 X:38442666-38442688 CATTGAAAGTGGAATGAAGGAGG + Intronic
1189187879 X:39069988-39070010 CATTGAAAGGTGAAGTTGGCTGG - Intergenic
1189307713 X:39999525-39999547 CTTTGAAAGGTTAAGGTGGGAGG + Intergenic
1189339761 X:40195921-40195943 CAGTGAAATGAGGAGGTATGAGG + Intergenic
1189363386 X:40370318-40370340 CATGGAAAGGACATGGCAGGAGG - Intergenic
1189441225 X:41037936-41037958 CTTTGGAAGGACAAGGTGGGTGG + Intergenic
1189680668 X:43512846-43512868 CATGGAAGGGAGAAAGGAGGAGG + Intergenic
1189850904 X:45175166-45175188 CATAGAAAGTAGCAGGTATGTGG + Intronic
1190602475 X:52107031-52107053 CATTGGAAGGCCAAGGCAGGAGG - Intergenic
1190608282 X:52167584-52167606 TATTGAAAAAACAAGGTAGGGGG + Intergenic
1190618807 X:52264926-52264948 CTTGGAAAGGAGTAGGGAGGTGG + Intergenic
1190625809 X:52337455-52337477 CTTGGAAAGGAGTAGGGAGGTGG - Intergenic
1190809676 X:53871096-53871118 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1190866621 X:54390241-54390263 CATTGGGAGGCCAAGGTAGGTGG - Intergenic
1192375848 X:70560990-70561012 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1192415976 X:70981151-70981173 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1193023086 X:76813688-76813710 GATTAGAAGGAGAAGGTAGGGGG - Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1194497328 X:94634189-94634211 CATTGAAAGGACACAGTAGGAGG + Intergenic
1194589016 X:95773482-95773504 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1195307285 X:103596447-103596469 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
1195402977 X:104481486-104481508 CTTTGAAGGGAGAAGGAATGGGG + Intergenic
1195625709 X:107004142-107004164 CAATGGAAGGCCAAGGTAGGAGG + Intergenic
1195874687 X:109527184-109527206 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1196195446 X:112834191-112834213 AATTGAAAGGAGAATGACGGTGG - Intronic
1196205758 X:112937513-112937535 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1196649910 X:118158103-118158125 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1196691367 X:118562349-118562371 CAATGAAAGTAGGAGGTAAGAGG - Intronic
1196968959 X:121087723-121087745 AATTCAGAGGAGAAGGTGGGAGG - Intergenic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1197503961 X:127278718-127278740 CATTGGGAGGCCAAGGTAGGAGG + Intergenic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1198116540 X:133549971-133549993 GATAGAAAAGAGAGGGTAGGTGG - Intronic
1198206832 X:134473690-134473712 CATTGAAGGGAGATGGAAGAAGG + Intronic
1198234422 X:134723554-134723576 CTTTGAAAGGCTAAGGCAGGAGG - Intronic
1198374339 X:136023052-136023074 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198728084 X:139697894-139697916 CTTTGGAAGGTCAAGGTAGGAGG + Intronic
1198997411 X:142589666-142589688 CATTGAAAGGAGAATGCAAGTGG + Intergenic
1199509439 X:148604499-148604521 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1199802508 X:151265606-151265628 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1199949551 X:152697243-152697265 AATTCAAAGGAAAAGGTATGTGG + Intergenic
1199951724 X:152712905-152712927 AATTCAAAGGAAAAGGTATGCGG + Intergenic
1199957959 X:152755543-152755565 AATTCAAAGGAAAAGGTATGCGG - Intergenic
1199960125 X:152771204-152771226 AATTCAAAGGAAAAGGTATGTGG - Intergenic
1200760074 Y:7029514-7029536 CATTGAGAGGCCAAGGTAGAAGG - Intronic
1200960085 Y:8988406-8988428 GATTGAAAGGTGAAGCTAGCTGG + Intergenic
1201361319 Y:13153069-13153091 CAGTGAGAGGTGAAGGTAGCTGG - Intergenic
1201499854 Y:14630003-14630025 CAATGACAGGTGAAGGGAGGAGG - Intronic
1201563242 Y:15340367-15340389 CATTGAAAGCAGTGTGTAGGGGG - Intergenic
1201684925 Y:16690446-16690468 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic