ID: 1197169949

View in Genome Browser
Species Human (GRCh38)
Location X:123421708-123421730
Sequence CAGTGGGAGCTGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1068
Summary {0: 1, 1: 1, 2: 10, 3: 106, 4: 950}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197169949_1197169957 9 Left 1197169949 X:123421708-123421730 CCACCTTCCCTCAGCTCCCACTG 0: 1
1: 1
2: 10
3: 106
4: 950
Right 1197169957 X:123421740-123421762 ACTTTACCTCCATTATCAGGTGG 0: 1
1: 0
2: 3
3: 5
4: 132
1197169949_1197169956 6 Left 1197169949 X:123421708-123421730 CCACCTTCCCTCAGCTCCCACTG 0: 1
1: 1
2: 10
3: 106
4: 950
Right 1197169956 X:123421737-123421759 GGCACTTTACCTCCATTATCAGG 0: 1
1: 0
2: 2
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197169949 Original CRISPR CAGTGGGAGCTGAGGGAAGG TGG (reversed) Intronic
900040891 1:463626-463648 CAATGAGAGCTGAGTGAAAGGGG + Intergenic
900062322 1:698602-698624 CAATGAGAGCTGAGTGAAAGGGG + Intergenic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900237998 1:1601538-1601560 AGGTGGGAGCTGGGGGCAGGGGG - Intergenic
900295457 1:1946919-1946941 CAGCTGGGGCTGGGGGAAGGTGG + Intronic
900496661 1:2978875-2978897 CAGGTGCAGCTGAGGGAAAGGGG + Intergenic
900704843 1:4073962-4073984 CTGTGAGCCCTGAGGGAAGGGGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900822589 1:4900631-4900653 GAGTGGGAGCTGAGGCATTGTGG + Intergenic
900932230 1:5744436-5744458 CACTGGGAGCTCCTGGAAGGAGG - Intergenic
901018352 1:6244034-6244056 GGGAGGGGGCTGAGGGAAGGAGG + Intergenic
901252367 1:7790348-7790370 GAATGGGAGCCGAGTGAAGGAGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901735501 1:11309733-11309755 AAATGGGAGCCGAGCGAAGGGGG - Intergenic
901749097 1:11395170-11395192 CTGTGGGAGCTTAGGAAGGGCGG + Intergenic
901829794 1:11885480-11885502 CAGTGGGACCTGGGGTAGGGAGG + Intergenic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902404765 1:16176576-16176598 CAGTGGGAGCTTGGAGGAGGAGG - Intergenic
902511436 1:16969049-16969071 CAGTGGGAGCAGAGGTATAGAGG + Intronic
902667028 1:17946680-17946702 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
902799098 1:18818419-18818441 GAGGGGGAGCTGAGGGAGGTGGG + Intergenic
902944164 1:19822250-19822272 CAGTGGAGGATGAGGGAAAGAGG - Intergenic
903337653 1:22635616-22635638 CAGTGGGAGCTGGGGACAGTGGG - Intergenic
903446675 1:23426758-23426780 CAGTGGCCGTTGAGGGGAGGAGG + Intergenic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
903790448 1:25889480-25889502 CTTGGGGAGCTGAGTGAAGGGGG - Intronic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904199566 1:28811263-28811285 CAGTGCGAGCAGATAGAAGGGGG - Intergenic
904334450 1:29787685-29787707 CAGGGGGAGATGAGCGAGGGAGG - Intergenic
904353625 1:29924606-29924628 CAGTAAATGCTGAGGGAAGGAGG - Intergenic
904719893 1:32500153-32500175 TGGTGGAGGCTGAGGGAAGGAGG + Intronic
904734872 1:32624021-32624043 AAGTGAGTGCTGAGCGAAGGGGG - Intronic
904887692 1:33753579-33753601 CTGGTGGAGCTGTGGGAAGGGGG + Intronic
904957546 1:34297617-34297639 AAAGGGGAGCTGAGGGCAGGGGG - Intergenic
904988730 1:34574018-34574040 CAGTGGGTGCCAGGGGAAGGGGG + Intergenic
905702489 1:40028646-40028668 AAGTGGGAGGTGAGAAAAGGGGG - Intergenic
905825519 1:41023486-41023508 AAGTGGGAGCTGTGGGGAAGAGG - Intergenic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906196778 1:43934660-43934682 CAGTGGGAGCTCAGGAAGGCTGG + Intronic
906468698 1:46108715-46108737 CTGTGCTAGCTCAGGGAAGGAGG - Intronic
906720218 1:47998592-47998614 CAGAGGTAGCTTAGAGAAGGAGG + Intergenic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907515964 1:54993657-54993679 CAGTGGGGGGTGGGGGGAGGGGG - Intergenic
907715728 1:56924238-56924260 CAGGAGGTGGTGAGGGAAGGAGG + Intergenic
907794026 1:57696329-57696351 CTGTGGGAGATGTGGGAAGCAGG + Intronic
907943394 1:59110258-59110280 CAGTGGGAGCAAAGGGACAGAGG - Intergenic
908376499 1:63547461-63547483 TAGTGAGTGCTGAGGGAATGTGG + Intronic
909784848 1:79598229-79598251 GAGTGGGGGCTGAGGGGAGGGGG + Intergenic
909840042 1:80309171-80309193 AAGTGAGAGCTGAGTGAAGGGGG - Intergenic
910176727 1:84438682-84438704 CGGTGGGTGGTGGGGGAAGGTGG + Intergenic
910243668 1:85115699-85115721 CAGGGGGAGGTGGGGGCAGGGGG + Intronic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
911039649 1:93581909-93581931 CTGATGGAGCTGAGGCAAGGGGG + Intronic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912552047 1:110490724-110490746 CAGTAGGTGCTGAGAGCAGGAGG + Intergenic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
914747952 1:150513134-150513156 CAGTAGAAGCTGATGAAAGGGGG + Intronic
915003088 1:152611494-152611516 CATTGGCAGCTGAGGGAGGTAGG - Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915213199 1:154324984-154325006 TGGTGGGGGCGGAGGGAAGGAGG + Exonic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
915277736 1:154801113-154801135 CTGGGGGAGATGAGGAAAGGAGG + Intronic
915288298 1:154866867-154866889 GAGGGGGAGCTCAGGGAAAGGGG - Intronic
915527529 1:156485211-156485233 CAGTGGGAGCTGGGGGGTAGGGG - Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
916309263 1:163376346-163376368 CTTTGGGAGCTCAAGGAAGGAGG - Intergenic
916586377 1:166153632-166153654 CAGTGCAAGCTTAGAGAAGGAGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917090481 1:171348416-171348438 GAATGAGAGCTGAGCGAAGGGGG + Intergenic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
917576102 1:176323322-176323344 CCCTGGGAGCTGAGGAAAGGTGG - Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
918067181 1:181109265-181109287 CAGAGAGAGCTGTGGGGAGGGGG + Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918265732 1:182839757-182839779 CCGCGGCGGCTGAGGGAAGGGGG + Intronic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
918811523 1:189127539-189127561 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
919974736 1:202603119-202603141 CTGTGGGAGCTGGGGGAGAGAGG + Intronic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920053357 1:203176272-203176294 CTGTGGGAGCCCAGGGAATGTGG - Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920269925 1:204755100-204755122 AAGTGGGGGCTGAGGGGTGGTGG + Intergenic
920303752 1:205005753-205005775 AAGTGGGATCTGGGGTAAGGTGG - Intronic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
920778160 1:208961215-208961237 CAGTGACAGCTGTGGGTAGGTGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
920992395 1:210952124-210952146 CAGTAGGTGCTGAGGGAGAGAGG - Intronic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921487657 1:215733954-215733976 CTGTTGGAGCTGTGGGAAGGGGG - Intronic
921821449 1:219621604-219621626 CAGTGAGAGATGAGGTAAGTAGG - Intergenic
922251842 1:223856495-223856517 GAGTGGGAGCAGAAGGGAGGCGG + Intergenic
922758550 1:228109812-228109834 GGGCGGGGGCTGAGGGAAGGAGG + Intergenic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923124451 1:231023043-231023065 CAGTGGGAACTGAGGACTGGAGG - Intronic
923745889 1:236700001-236700023 CAGAGGCAGCTGTGGGAAGTAGG - Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1063813450 10:9742028-9742050 GATTGAGAGCTGAGTGAAGGGGG - Intergenic
1063914939 10:10871782-10871804 CACTGGGAGCTGAAGGAGAGAGG + Intergenic
1063989557 10:11545231-11545253 CACTGGAGGCTGAGGGAGGGTGG - Intronic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064370560 10:14748920-14748942 CAGTGGGCGCTTAAGCAAGGAGG - Intronic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1065326826 10:24556865-24556887 CAGAGGGAGCCGCGGGTAGGTGG - Intergenic
1065777321 10:29132918-29132940 CAGTGTGAGCTGATGGGAAGAGG - Intergenic
1066454851 10:35564326-35564348 CACTGGGACCTGTGGGCAGGCGG - Intronic
1067095798 10:43298750-43298772 CAGTGGGAGGTGGGGGAACCAGG - Intergenic
1067517836 10:46968832-46968854 CAGTGGGAACTGAGAGATGGGGG - Intronic
1067644412 10:48082997-48083019 CAGTGGGAACTGAGAGATGGGGG + Intergenic
1069124152 10:64608025-64608047 GAGTGGGAGATGAGGGAGTGGGG + Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069752591 10:70753827-70753849 CAGCCGGAGCTGTGGGAAGCTGG + Exonic
1069773226 10:70912387-70912409 GAATGAGAGCTGAGTGAAGGAGG + Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1069913432 10:71773280-71773302 GAGTGGGAACTGTGGGATGGGGG - Intronic
1069957587 10:72061416-72061438 CCCTGGGGGCTGAGGGAAGTGGG + Exonic
1069984178 10:72272842-72272864 CAGTGGTTGCTGAGGGTGGGTGG - Intergenic
1069985548 10:72280498-72280520 CAGAGGAAGCTGAGGAAATGTGG + Intergenic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070655609 10:78269155-78269177 TATGGGGAGCTGAGGGAAGCAGG - Intergenic
1070733165 10:78845636-78845658 GAGTGGGTGCTCAGGGCAGGGGG - Intergenic
1070734725 10:78855616-78855638 CAGTGGGAGATGAGGCAGGCAGG + Intergenic
1070842269 10:79495403-79495425 CAGTGGGGGCAGAGGGGAAGCGG + Intergenic
1071295940 10:84219719-84219741 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072226537 10:93375252-93375274 CAGTGGCAGCTGAGAGAAACTGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073113041 10:101073966-101073988 CTGGGGGAGCTGCGGGCAGGTGG + Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1073956019 10:108872305-108872327 AAGTGAGAGGTAAGGGAAGGAGG + Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1074714266 10:116203554-116203576 GAGAGGCAGCTGGGGGAAGGTGG + Intronic
1074948055 10:118300258-118300280 CAGAGGGAGATGAGGAAATGAGG + Exonic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075402512 10:122171328-122171350 CAGTGGGGGCCGAGGTAGGGGGG + Intronic
1075597108 10:123739975-123739997 AAGTGGGAGCTGAGCCCAGGAGG - Intronic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1075988003 10:126804808-126804830 ACGTGTGGGCTGAGGGAAGGAGG - Intergenic
1076366212 10:129922415-129922437 CAGTAGGTGCTGAGGGCCGGGGG - Intronic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076967165 11:99856-99878 CAATGAGAGCTGAGTGAAAGGGG + Intergenic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077391851 11:2303944-2303966 CAGACGGCCCTGAGGGAAGGAGG - Intronic
1077914690 11:6603696-6603718 CGGTGGGAGGGGAGGGACGGAGG + Intronic
1078357581 11:10643745-10643767 CGGTCGGAGCTTAGGGAGGGAGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1078529719 11:12127615-12127637 CTTTGGGAGCACAGGGAAGGAGG + Intronic
1079089064 11:17468108-17468130 GAATGGGAGCTGGGGGAAGCAGG - Intronic
1079298027 11:19252107-19252129 CAGTGGGAGGTCGGGGAAGGGGG - Intergenic
1080542352 11:33280013-33280035 CTGGGGGAGCTGAGGGGAGGTGG + Intronic
1080874869 11:36266130-36266152 CCAGGGAAGCTGAGGGAAGGTGG - Intergenic
1081232155 11:40598799-40598821 CAGAGGGTGCTGGGGGAGGGAGG + Intronic
1081335293 11:41857846-41857868 CAGTGGTGGCTGACGGAAAGAGG + Intergenic
1081541394 11:44037084-44037106 CAGTGGGAGATGGGGAAAGGAGG - Intergenic
1081660154 11:44883125-44883147 TCTTGGGAGCAGAGGGAAGGTGG - Intronic
1081693785 11:45095326-45095348 CTGAGGGAGCTGAGGGCTGGAGG - Intergenic
1081869957 11:46378924-46378946 GCGTGTGAGCTCAGGGAAGGAGG + Intronic
1083136755 11:60685765-60685787 CAGTTTGAGTTGAGGGTAGGGGG - Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084401080 11:68943276-68943298 CATTGGCAGCTGAGGGCTGGGGG - Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084892950 11:72245316-72245338 CAGATGGAGCTGAGGGAACGGGG - Intronic
1085450696 11:76630337-76630359 CAGGGGCAGCTGCTGGAAGGAGG - Intergenic
1085555866 11:77421139-77421161 CAGGGTGAGATGAGGGGAGGAGG - Intronic
1085644999 11:78217125-78217147 GAGTGGGGGATCAGGGAAGGTGG - Exonic
1086606504 11:88702404-88702426 CTGTGAGAGCTGAGCGAAGCAGG - Intronic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088753584 11:112866375-112866397 CTTTGGGAGCTGATTGAAGGAGG - Intergenic
1088829318 11:113521951-113521973 GAAAGGGAGCTGATGGAAGGAGG + Intergenic
1089058942 11:115610246-115610268 CACTGGGGCCTGTGGGAAGGGGG - Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089917430 11:122171741-122171763 CAGGGAGAGATGAGGAAAGGAGG + Intergenic
1090263934 11:125342422-125342444 CACTGGGAGCTGGGGGGAGGAGG - Intronic
1090440739 11:126723344-126723366 TAGTGGGAGCTGTGGAGAGGAGG + Intronic
1090974599 11:131670853-131670875 CAGAGGGAGCAGAGGGGAAGGGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091945722 12:4539549-4539571 CAGTGGGAGGTGAGGTTAGGGGG + Intronic
1092114792 12:5992355-5992377 AGGAGGAAGCTGAGGGAAGGAGG - Intronic
1092223011 12:6728142-6728164 AAGTGGGAGGGAAGGGAAGGAGG + Intronic
1092535013 12:9379192-9379214 CACAGGGTGCTGAGGGCAGGAGG + Intergenic
1093863274 12:24194260-24194282 CTGTGGGGGGTGATGGAAGGTGG + Intergenic
1093988957 12:25569008-25569030 CTGGTGGAGCTGTGGGAAGGGGG + Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096113923 12:49044158-49044180 CAGTGGGGCCTGGGAGAAGGTGG - Intronic
1096439983 12:51633134-51633156 AAGAGGGTGCTGAGGGGAGGAGG + Intronic
1096773252 12:53949750-53949772 CACAGGGAGCACAGGGAAGGGGG + Intergenic
1096809245 12:54159212-54159234 CAGTGAGGGCTGAGGGCTGGGGG - Intergenic
1097329171 12:58314609-58314631 CAGGGGGAGCTGAGGCCAGAGGG - Intergenic
1098010366 12:66044401-66044423 CTGTGGGGGCTGAGGCAAAGTGG + Intergenic
1100144470 12:91660518-91660540 CAGAGGTAGATGAGGGGAGGGGG + Intergenic
1100221134 12:92505574-92505596 CACTGGCAGCTGGGGGAAGTGGG + Intergenic
1100301900 12:93315308-93315330 CATTGGGTGCTGAGGGAGGCGGG - Intergenic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1103320672 12:120091079-120091101 CAGTGGGCCATGAGGGGAGGCGG - Intronic
1103350596 12:120280845-120280867 CTTTGGGAGGTCAGGGAAGGTGG + Intergenic
1103856518 12:123973716-123973738 TTGTTGGAGCCGAGGGAAGGGGG + Exonic
1104174048 12:126312021-126312043 GAATGAGAGCTGAGCGAAGGGGG + Intergenic
1104239466 12:126973823-126973845 AAGAGAGAGTTGAGGGAAGGGGG + Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104932828 12:132348846-132348868 AAGTGGGGGCTGACTGAAGGGGG - Intergenic
1104943298 12:132404789-132404811 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1105007336 12:132729522-132729544 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105007347 12:132729544-132729566 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105007373 12:132729601-132729623 GAGGGGGAGGTGAGGGGAGGGGG + Intronic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1106143113 13:27027442-27027464 TAGTGGGAGCTGAGGGAGGGAGG + Intergenic
1106383687 13:29264420-29264442 CTGGGGGAGCTATGGGAAGGGGG - Intronic
1106478320 13:30116665-30116687 CAGTGGCAGCTGGGGGATAGGGG + Intergenic
1106634941 13:31518594-31518616 CAGTGGAATCTGAGGAAAGCTGG + Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1108258084 13:48629760-48629782 CAGTGGGGGCTGGTGGGAGGTGG + Intergenic
1108738869 13:53314107-53314129 GAGTGTGAGCTGAGGCCAGGAGG + Intergenic
1109189667 13:59309192-59309214 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
1110032337 13:70631531-70631553 CAGAGGGAGCTGAGTGCAGTGGG - Intergenic
1110187460 13:72692065-72692087 GAATGGGTGCTGAGTGAAGGAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1110693364 13:78458020-78458042 CATTGGGAGGTGAAGGAGGGAGG - Intergenic
1110758865 13:79208011-79208033 AAGTGCCAGCTGAGGGTAGGAGG + Intergenic
1111144166 13:84158299-84158321 CTGAGGGACCTGAGTGAAGGAGG - Intergenic
1111985373 13:95060905-95060927 CACCAGGGGCTGAGGGAAGGTGG - Intronic
1112077442 13:95929169-95929191 CAGAGGGAGATGAGGGAGAGGGG + Intronic
1112098168 13:96158250-96158272 TAGAGGGAGATGCGGGAAGGAGG + Intronic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1112857083 13:103785652-103785674 AAATGAGAGCTGAGTGAAGGGGG + Intergenic
1113385768 13:109846514-109846536 CAGTGGGAGCTGAGAAAACTGGG + Intergenic
1114062329 14:19029472-19029494 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1114099930 14:19370521-19370543 CAGGGGGTGTTGTGGGAAGGTGG + Intergenic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1114496743 14:23138069-23138091 AAGTGGGAGCTGAGGGGTCGGGG - Intronic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1115403871 14:32994110-32994132 CTGGGGGAGCTGGAGGAAGGGGG + Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115450613 14:33543133-33543155 CAGAAAGAGATGAGGGAAGGAGG - Intronic
1115612489 14:35062028-35062050 AACTGGAAGCTGAGGGGAGGGGG + Intronic
1115779750 14:36756206-36756228 CGGGGGCAGCTGAGGGAAGGTGG + Intronic
1116360642 14:43992168-43992190 CACTGGGACCTATGGGAAGGTGG + Intergenic
1117489136 14:56228775-56228797 GAGTGTGAGCTGAGGCAGGGTGG + Intronic
1117791763 14:59349226-59349248 CAATAGGAGCTGAAGGCAGGAGG - Intronic
1117847445 14:59925979-59926001 GAATGAGAGCTGAGTGAAGGGGG - Intronic
1117930755 14:60838630-60838652 CAGTGGGAGCTGGGAACAGGTGG + Intronic
1118166967 14:63346348-63346370 CATTGAGGGCTGGGGGAAGGGGG - Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1118753046 14:68820327-68820349 AAGGGGGAGGTGAGGGCAGGTGG - Intergenic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1119163991 14:72477123-72477145 CTGTGGGAGCTGGAGGAAGGAGG + Intronic
1119264398 14:73255460-73255482 GACTGTGTGCTGAGGGAAGGAGG + Intronic
1119288627 14:73476425-73476447 CTGTAGGAGTTCAGGGAAGGGGG - Intergenic
1121049819 14:90812976-90812998 AAGTGGGAGCTTTGGGAAGGAGG + Intronic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121377747 14:93430225-93430247 AAGTTGGGGCTGAAGGAAGGAGG - Intronic
1121529084 14:94640119-94640141 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
1121571260 14:94948326-94948348 TAGTGGGAGCTGTAGGCAGGGGG - Intergenic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1123065300 14:105616083-105616105 ACGTGGGTGCTGAGGGGAGGAGG + Intergenic
1202833838 14_GL000009v2_random:63074-63096 CAGTGGGAGGTGGGGGTGGGAGG + Intergenic
1124037920 15:26073492-26073514 AAGTGGTGGCTGAGGGAAGGAGG + Intergenic
1124439161 15:29674703-29674725 CCGGGGGGGCGGAGGGAAGGAGG + Intergenic
1124624882 15:31302158-31302180 CAGTGGGAACTGTGGGACAGAGG + Intergenic
1124685755 15:31780485-31780507 CGGCGGGAGCTGTGGGAAGGTGG + Intronic
1124871875 15:33551915-33551937 GAGTGGGAGCTGAAGGTGGGCGG + Intronic
1124907685 15:33886594-33886616 GAATGAGAGCTGAGTGAAGGGGG - Intronic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125999435 15:44195216-44195238 CGGTGGCGGCTGAGGGAAGGAGG - Exonic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126385940 15:48093479-48093501 CTGAGGAAGATGAGGGAAGGGGG - Intergenic
1127133566 15:55895504-55895526 CTGTGGTAGCTGAGGAAAGCTGG + Intronic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128119254 15:65133602-65133624 CAGCGGAGGCTGAAGGAAGGGGG + Exonic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128444220 15:67742505-67742527 AAGGGGCAGCTGGGGGAAGGAGG - Intronic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128677920 15:69625256-69625278 CAGAGGGGGCTTGGGGAAGGGGG + Intergenic
1128893246 15:71349843-71349865 CAGTGTGGGCCCAGGGAAGGGGG + Intronic
1128990954 15:72260076-72260098 CTTTGGGAGGTGAAGGAAGGCGG + Intronic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129844366 15:78761485-78761507 CAGGTGGTGCTCAGGGAAGGTGG - Intronic
1129913479 15:79247300-79247322 GAGTGTGTGCTCAGGGAAGGAGG - Intergenic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130257434 15:82332294-82332316 CAGGTGGTGCTCAGGGAAGGCGG + Intergenic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1130458799 15:84142388-84142410 CAGTGGGAGCTCTGGCAAGTTGG + Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130597511 15:85257671-85257693 CAGGTGGTGCTCAGGGAAGGCGG - Intergenic
1130742448 15:86615392-86615414 CAGTGGGATCTGGGGTAAGGAGG + Intronic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131336431 15:91553617-91553639 CAGTGGGTGATTAGGAAAGGTGG + Intergenic
1132441009 15:101863979-101864001 CAATGAGAGCTGAGTGAAAGGGG - Intergenic
1132460791 16:53607-53629 CAGTGGGAGCTGCCGGGAGTTGG - Exonic
1132579471 16:678430-678452 CTGTGGGAGCTGGGGGCACGCGG + Intronic
1132869748 16:2110650-2110672 CTGTGGGATCTGGGGGACGGTGG - Exonic
1132906228 16:2284129-2284151 CTGTGGGAGGTGGGGCAAGGCGG + Intronic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1133776806 16:8903016-8903038 GAGTGGGAGATGAGGAAAAGGGG + Intronic
1134008631 16:10834992-10835014 CAGTGAGAGCTGAGGAAGAGGGG - Intergenic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134717673 16:16364951-16364973 CTGTGGGATCTGGGGGACGGTGG + Intergenic
1134957079 16:18387208-18387230 CTGTGGGATCTGGGGGACGGTGG - Intergenic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135047914 16:19169134-19169156 CACTGGGTGCTGAGGGGTGGGGG + Intronic
1135293580 16:21260764-21260786 AAGTGGGAGAGTAGGGAAGGAGG + Intronic
1135615553 16:23908118-23908140 CCCTGGGAGCTGGGGGAAGGAGG + Intronic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136538269 16:30913290-30913312 AACTGTGAGCTGAAGGAAGGAGG + Intergenic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137603639 16:49772989-49773011 GAGTGAGTGCTGAGCGAAGGGGG + Intronic
1138485037 16:57335456-57335478 CTGTGGGGGATGAGGGAATGGGG - Intergenic
1138492830 16:57386501-57386523 CAGGGGGAGCTCACGGCAGGGGG - Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1139172413 16:64647923-64647945 AAGTGGCTGCTGAGGAAAGGGGG + Intergenic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1140956828 16:79874169-79874191 CAGTGGGTGCTTGGTGAAGGAGG + Intergenic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141389067 16:83649394-83649416 CAGTGGGAGGTGAGGAAATACGG + Intronic
1141673157 16:85503367-85503389 GAGCGGCAGCTGAGGGCAGGTGG - Intergenic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1142124541 16:88403632-88403654 CTGTGGGGGCCGAGGGCAGGAGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142544275 17:688289-688311 GAATGAGAGCTGAGCGAAGGGGG - Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1143023946 17:3930151-3930173 GAGTGGGGGCTGAGGGCTGGGGG - Intronic
1143023977 17:3930243-3930265 GAGTGGGGGCTGAGGGCTGGGGG - Intronic
1143032845 17:3977266-3977288 CAGTGGGGGCTCAGGGTGGGAGG + Intergenic
1143384926 17:6523521-6523543 CAGTGAGAGCTAAGGGCAGTCGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144234407 17:13243643-13243665 TAGGTGGAACTGAGGGAAGGTGG - Intergenic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144962267 17:19051589-19051611 CACTGGGAGCTGGGGGCAGAGGG - Intergenic
1144972894 17:19122931-19122953 CACTGGGAGCTGGGGGCAGAGGG + Intergenic
1145762511 17:27433844-27433866 AAGCGGGGGCTGAGGGATGGAGG - Intergenic
1145791891 17:27632528-27632550 CAGAGGGGGCTGGGGGAAGCTGG + Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146641686 17:34546727-34546749 CATTGAGGGCTGATGGAAGGAGG + Intergenic
1146826548 17:36028330-36028352 GAGTGAGAGCTGAGAGAAAGTGG + Intergenic
1147058611 17:37855151-37855173 CAGTGGTAGCTGCTGGAATGAGG + Intergenic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1147938710 17:44029734-44029756 CAGTGGCAGCGGAAGCAAGGAGG - Intergenic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1147979317 17:44264996-44265018 CACTGGGGGCTGTGGGGAGGGGG + Intronic
1149216530 17:54361191-54361213 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
1149256975 17:54837354-54837376 CAGTGGGAGCTGGGAACAGGGGG - Intergenic
1150004222 17:61459889-61459911 CAGTGGTTGCTGAAGGAGGGGGG - Intronic
1150219169 17:63486466-63486488 AAGTGGGAGCTGAGGGCTGGAGG - Intronic
1150689590 17:67353302-67353324 GAGAGGGAGCGGGGGGAAGGAGG - Intronic
1150959198 17:69895659-69895681 CAGCAGGAGCTGAGAGATGGAGG + Intergenic
1151185238 17:72359397-72359419 CAATGGGAGGTGAGGGAGGCTGG - Intergenic
1151626276 17:75277809-75277831 GAGTGGGAGATGGGGGCAGGGGG - Intronic
1151653916 17:75486593-75486615 CAGTGAGAGCTGTGGGATGGTGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152261200 17:79268288-79268310 AAATGGGAGGTGAGGCAAGGTGG - Intronic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152728702 17:81959832-81959854 CACGGGGAGCTCAGGGACGGCGG + Intronic
1152742013 17:82022598-82022620 CAGCCGGGGCTGCGGGAAGGTGG - Intronic
1152793836 17:82296972-82296994 CATGGGGCGCTGGGGGAAGGCGG - Intergenic
1153008619 18:518151-518173 CACTTGGAGCTTAGTGAAGGGGG - Intergenic
1153051761 18:907495-907517 GGGTGGGAGCAGAGGTAAGGAGG - Intronic
1153387239 18:4511323-4511345 CAGTGGGAGAACTGGGAAGGAGG - Intergenic
1153402340 18:4694879-4694901 GAGTGTGAGCTGAGGCAGGGCGG + Intergenic
1153439839 18:5104195-5104217 CTTTGGGCGCTGGGGGAAGGGGG - Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153809864 18:8742489-8742511 AAGTGAGAGCTGAGCAAAGGGGG + Intronic
1153846312 18:9052674-9052696 CAGTAGGGGCTGGGAGAAGGAGG + Intergenic
1154010339 18:10568744-10568766 CTCTGGGAGCTGAGAGAAGAGGG - Intergenic
1154063414 18:11084522-11084544 CCGTGGGAGGTGAGGAAAGGGGG - Intronic
1154426021 18:14272569-14272591 CAGTGGGAGTTGGGGGTGGGTGG + Intergenic
1154428268 18:14288661-14288683 CAGTGGGAGCTGGGGGTGGGGGG + Intergenic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1154433709 18:14327809-14327831 CAGTGGGAGGTGGGGGTGGGTGG + Intergenic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155215638 18:23641211-23641233 CAGTGGGAGCTGGAAGCAGGTGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1156060751 18:33072961-33072983 CAGTGGGAGCTGAGGATATTTGG + Intronic
1156290486 18:35745375-35745397 GAATGAGAGCTGAGCGAAGGGGG - Intergenic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157569260 18:48701524-48701546 CACTGGGGGCTGGGGGACGGAGG - Intronic
1157692411 18:49694426-49694448 CGGTGGAAGCTGGGGAAAGGAGG - Intergenic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1157994146 18:52534997-52535019 CAGGGGGAGATGGGGGAAAGTGG - Intronic
1158364147 18:56712144-56712166 CACTGGGAGCTGTTGGAAAGTGG + Intronic
1159020968 18:63142730-63142752 CAAGGGGAGCTGACGGATGGTGG + Intronic
1159095753 18:63899632-63899654 CAGTGGGATCTTAGGGGAGCCGG - Intronic
1159770776 18:72543551-72543573 GAGTGGGAGCTGTCGGGAGGAGG + Intronic
1159839160 18:73376603-73376625 GAATGAGAGCTGAGCGAAGGGGG + Intergenic
1159976990 18:74726163-74726185 CAGTGGGAGCTGAGTGGAAGGGG - Intronic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160134616 18:76261873-76261895 CAGTGGGAGCGCTGGGAGGGAGG + Intergenic
1160166945 18:76522194-76522216 GTGGGGGAGCTGAGTGAAGGAGG + Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160357198 18:78238705-78238727 CAGTGGGAGCCGCGGGCAGGCGG + Intergenic
1160362564 18:78296281-78296303 CAGTGTGAGCTGGGGGCACGGGG + Intergenic
1160390494 18:78527699-78527721 GAGTGGGAGCTGTGGGGAGCAGG - Intergenic
1160624268 18:80192414-80192436 CAGTGGGAGCCCAGGGGACGGGG + Intronic
1160643968 19:169479-169501 CAATGAGAGCTGAGTGAAAGGGG + Intergenic
1160878741 19:1310088-1310110 CAATGGGATCACAGGGAAGGCGG - Intergenic
1160880016 19:1315479-1315501 CGCTGTGAGGTGAGGGAAGGAGG + Intergenic
1161090924 19:2359902-2359924 GAGTGGGCGCTGTGGGCAGGTGG - Intergenic
1161370607 19:3908859-3908881 GAGAGGAAGATGAGGGAAGGAGG - Intronic
1161381854 19:3969746-3969768 GAGTGGAAGCTGCTGGAAGGCGG - Exonic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1161569130 19:5020607-5020629 CCGCGGGCGCTGGGGGAAGGGGG + Intronic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1162343267 19:10105249-10105271 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1162905314 19:13819519-13819541 CAGGGGGAGCTGGGGGGAAGAGG + Intronic
1162957199 19:14105986-14106008 GAGAGGGAGCTTTGGGAAGGCGG + Intronic
1163097131 19:15067298-15067320 CTTTGGGAGGTGAGGGCAGGAGG + Intergenic
1163130728 19:15271203-15271225 CAGTGGGAACTGAAGCAGGGAGG - Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163627856 19:18401132-18401154 CAGTGAGAGGTGGGGGGAGGGGG - Intergenic
1164673143 19:30084543-30084565 CAGAGGGAGCCCAGGGAATGTGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165404924 19:35623736-35623758 CAGTTGCCTCTGAGGGAAGGTGG + Exonic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1165996697 19:39848745-39848767 CAGAGGGAGTTGAGGAAATGGGG - Intergenic
1166160507 19:40949231-40949253 CTGAAGGGGCTGAGGGAAGGGGG + Intergenic
1166169386 19:41016824-41016846 CTGAAGGGGCTGAGGGAAGGGGG + Exonic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167225709 19:48238132-48238154 CACTGGGAGGCGAGGGCAGGTGG - Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167689440 19:50975837-50975859 CAGAGGGAGATGAGATAAGGAGG + Intergenic
1167817688 19:51898532-51898554 AAGTGGGGGGTGGGGGAAGGGGG - Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
1202638840 1_KI270706v1_random:64618-64640 CAGTGGGAGTTGCGGGTGGGAGG - Intergenic
925202414 2:1979288-1979310 CCGTGGCAGCAGAGAGAAGGAGG + Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925656968 2:6159521-6159543 CAGAGGGAGATGGGGGTAGGGGG - Intergenic
926346143 2:11947435-11947457 GAATGAGAGCTGAGAGAAGGAGG + Intergenic
926964672 2:18396739-18396761 CACTGGGAGCTTCTGGAAGGTGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
927471958 2:23384135-23384157 CCGGGGGAGCGGAGGGAGGGTGG + Intergenic
927675440 2:25102502-25102524 GAATGAGAGCTGAGCGAAGGGGG + Intronic
927885875 2:26718181-26718203 CTGTGGGAGATGGGGGCAGGTGG - Intronic
928217121 2:29371070-29371092 ATGTTGGAGCTGAGGGAAGGAGG + Intronic
928233051 2:29516409-29516431 TAGTGGTAGCTGAACGAAGGGGG + Intronic
928889660 2:36189031-36189053 GACTGGGAGCTAAGGGAAGAGGG - Intergenic
929188349 2:39118587-39118609 AAGTGGGGGCTGTGGTAAGGTGG + Intronic
929532290 2:42760854-42760876 TAATGGGAGCTGGGGGCAGGCGG - Intergenic
929606595 2:43238887-43238909 CTGTGGGAGCTGGGGGTTGGTGG + Intronic
930000304 2:46856700-46856722 CAAGGGGAGGTGAGAGAAGGAGG + Intronic
930844770 2:55890917-55890939 GAAAGGGAGCTTAGGGAAGGAGG + Intronic
931226081 2:60333353-60333375 AGGTGGGAGCTGAGGGAGTGGGG + Intergenic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932317279 2:70793549-70793571 GAGTGGGAGCTGAAGAAGGGTGG - Intergenic
932417807 2:71584263-71584285 GAGTGGGAGCAGAGGCAAAGCGG + Intronic
932471871 2:71964538-71964560 AAATGGGAGCTGAGGAAAGTCGG + Intergenic
932496936 2:72150214-72150236 CAAGGGGGGCTGAGGGAAGCAGG - Intergenic
932952121 2:76305714-76305736 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
933047301 2:77555354-77555376 GAGTGAGTGCTGAGTGAAGGGGG - Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933643363 2:84787927-84787949 CACTGGGAAGTGGGGGAAGGAGG + Intronic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
933998231 2:87685640-87685662 GAGGGGCAGCTGAAGGAAGGAGG + Intergenic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934494300 2:94784142-94784164 CAGTGGGAGGTGGGGGTGGGAGG - Intergenic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935811356 2:106800643-106800665 CAGCAGGAGCTAGGGGAAGGAGG - Intergenic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
936295619 2:111265233-111265255 GAGGGGCAGCTGAAGGAAGGAGG - Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
938537648 2:132258277-132258299 CTTTGGGAGGCGAGGGAAGGTGG + Intergenic
939019053 2:136937293-136937315 AAGTAAGAGGTGAGGGAAGGAGG - Intronic
939152128 2:138485511-138485533 AAGTGGGAGCTGAGAGAAGGAGG + Intergenic
939447977 2:142334497-142334519 CTAGTGGAGCTGAGGGAAGGAGG - Intergenic
940199567 2:151135392-151135414 GAGCGGGAGCAGAGGGAAAGTGG - Intergenic
940220645 2:151347871-151347893 AAGTGAGTGCCGAGGGAAGGAGG + Intergenic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
942590472 2:177540465-177540487 AAGTGGGGGCTGGGGGTAGGGGG - Exonic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943797949 2:192021795-192021817 CTGTGTGAGCTGAAGTAAGGAGG + Intronic
944472720 2:200072201-200072223 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945207147 2:207344304-207344326 CAGAGGGAGCTGAAGCAGGGTGG + Intergenic
945297114 2:208181732-208181754 CAGTGGCAGCGCAGGGGAGGTGG - Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946037682 2:216756702-216756724 CAGGGGGAGCTGCCGGAAGAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
948630238 2:239297710-239297732 CAGAGGGTGCTGAGGGGATGGGG - Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948804047 2:240445500-240445522 AAGAGGGAGCTCAGGGGAGGGGG + Intronic
948883676 2:240872741-240872763 CAGAGGGAGCTGGGGGAGTGAGG - Intronic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
1168748411 20:264466-264488 CAGTTGAAGCTGAGGGTAGAGGG - Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1169710005 20:8550457-8550479 GAATGAGAGCCGAGGGAAGGGGG - Intronic
1169934831 20:10872095-10872117 AAGTGGGAGCTCTAGGAAGGAGG - Intergenic
1170286470 20:14715174-14715196 GAATGAGAGCTGAGCGAAGGGGG + Intronic
1170370119 20:15639455-15639477 CAGTGGGGGCTGAGGAGAGTAGG - Intronic
1170494855 20:16914895-16914917 TAGTGGGAGCTGGGGAAAAGTGG + Intergenic
1170738163 20:19028346-19028368 AAGTGGTAGCTGAGGGAGTGGGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171188570 20:23141775-23141797 GAGTGTGATCTGAGGGGAGGTGG + Intergenic
1171221384 20:23401072-23401094 AAGAGGGAGCTGAAGGAAGCAGG + Intronic
1171302901 20:24079184-24079206 CAGCGGGAGAAGAGGCAAGGAGG + Intergenic
1171327739 20:24310581-24310603 CAGGGGAAACTGAGGAAAGGGGG - Intergenic
1171811108 20:29744465-29744487 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1171866559 20:30490060-30490082 CTTTGGGAGGCGAGGGAAGGTGG + Intergenic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1172361624 20:34316624-34316646 CCGTAGGAGCAGAGAGAAGGAGG + Intergenic
1172385581 20:34531902-34531924 CAGAGGGATCTGTGAGAAGGTGG + Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173841278 20:46158661-46158683 CAGTGGGAGGTGGGCCAAGGGGG + Intergenic
1174123498 20:48285631-48285653 CAGTGGGAGAGGAAGCAAGGCGG + Intergenic
1174512217 20:51062202-51062224 GAATGAGAGCTGAGCGAAGGGGG - Intergenic
1175191295 20:57213730-57213752 CAGTGGGTGCTCAGGGATGTAGG + Intronic
1175312926 20:58024364-58024386 CAGAGGGGGCTGAGGGCAGCAGG + Intergenic
1175504613 20:59472741-59472763 CAGTGGGAAGTGGGGTAAGGGGG + Intergenic
1175563248 20:59951055-59951077 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
1175814643 20:61877149-61877171 CAGGGGGAGCTGAGCCCAGGAGG - Intronic
1175948905 20:62571951-62571973 AAGTGGGGCCTGTGGGAAGGCGG + Intergenic
1176077616 20:63255365-63255387 CAGCGGGAGATCAGGGCAGGTGG + Intronic
1176078451 20:63259828-63259850 CAGTGGGAGCTCTGGGCGGGTGG + Intronic
1176100526 20:63362371-63362393 CAGTGGCTGCTCAGGGAAGCTGG - Intronic
1176244697 20:64091883-64091905 AGGTGGGGGCTGCGGGAAGGTGG - Intronic
1176846007 21:13877270-13877292 CAGTGGGAGTTGGGGGTGGGTGG - Intergenic
1177161928 21:17557337-17557359 AAGTGGGAGCTGTGAGGAGGTGG - Intronic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1178454358 21:32733556-32733578 AAATGAGTGCTGAGGGAAGGGGG - Intergenic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178602251 21:34004809-34004831 CAGTGGGAGGGGAGGTATGGGGG - Intergenic
1178683009 21:34689021-34689043 CAGTGTGGGGTGAGGGAATGAGG + Intronic
1179150601 21:38805731-38805753 AAGCGGGAGGAGAGGGAAGGGGG - Intronic
1179682349 21:43032309-43032331 CGGAGGGTGGTGAGGGAAGGAGG - Exonic
1180078096 21:45473291-45473313 CAGAGGGAGCGGTGGGTAGGTGG + Intronic
1180156098 21:45977968-45977990 GAGGGGGAGATGAGGAAAGGGGG + Intergenic
1180156154 21:45978125-45978147 GAGGGGGAGAGGAGGGAAGGGGG + Intergenic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180341997 22:11627443-11627465 CTTTGGGAGGCGAGGGAAGGTGG - Intergenic
1180363124 22:11917271-11917293 CAGTGGGAGTTGGGGGTGGGAGG + Intergenic
1180480822 22:15752099-15752121 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1181148040 22:20862645-20862667 CAGTGAGAGCTGAGGCAGAGTGG + Intronic
1181533687 22:23531112-23531134 CACTGGGTCCTGAGGGCAGGTGG + Intergenic
1181602406 22:23960267-23960289 CGGTGAGGGGTGAGGGAAGGAGG + Intronic
1181606105 22:23981040-23981062 CGGTGAGGGGTGAGGGAAGGAGG - Intronic
1181911680 22:26243401-26243423 CAGAGAGAGCTGAGTGAATGAGG + Intronic
1182008253 22:26979364-26979386 CAGTGGGAGCTGTGGAAGGCAGG - Intergenic
1182118924 22:27774484-27774506 CAGTGGGAGCTGAAAGCAGGAGG - Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1183000875 22:34857605-34857627 CACTGGGGCCTGAGGGGAGGTGG - Intergenic
1183035350 22:35136916-35136938 CATTGAGAGGTGAGGGCAGGTGG - Intergenic
1183933199 22:41247826-41247848 GGCTGGGAGCTGAGGGAAGAGGG + Intronic
1184187321 22:42873472-42873494 CTCTGGGTGCTGAGGGGAGGAGG + Intronic
1184586730 22:45452924-45452946 CAGTTCTAGCTGAGGGATGGTGG - Intergenic
1184755170 22:46511766-46511788 GAGGGTGAGATGAGGGAAGGAGG + Intronic
1184797289 22:46739531-46739553 GAGCGGCAGCTGAGGGAGGGAGG - Intergenic
1184943233 22:47783719-47783741 CAGGGGTGGCTGTGGGAAGGCGG - Intergenic
1185136481 22:49076252-49076274 CAGGAGGTGGTGAGGGAAGGTGG + Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185325111 22:50221719-50221741 CAGTGGGGGCTGGTGGCAGGGGG - Exonic
949926924 3:9048937-9048959 CATGGGGACCTGCGGGAAGGAGG + Intronic
950098968 3:10345820-10345842 CTGGGGGAGCTGTGTGAAGGGGG - Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950126270 3:10511625-10511647 CAGTGGGATCTGAGTGGAGTTGG - Intronic
950204484 3:11068228-11068250 GAGTGGGTGCAGAGGTAAGGAGG - Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950375587 3:12569620-12569642 CAGTGGGAGATGATGGAAGTAGG + Intronic
951139902 3:19147617-19147639 GAGTGGGGGCTGGGGAAAGGGGG + Intergenic
951176022 3:19600949-19600971 TAATGGGAGGTGGGGGAAGGTGG + Intergenic
951177240 3:19616068-19616090 TAATGAGAGCTGAGTGAAGGGGG + Intergenic
952730487 3:36632940-36632962 TAGTGGGAGCTGAGGTTATGGGG + Intergenic
952819480 3:37473472-37473494 CTGGGGGTGCTGTGGGAAGGGGG + Intronic
953347048 3:42184976-42184998 CAGCAGGAGCTGCAGGAAGGTGG - Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954390972 3:50267772-50267794 AAGTGTCAGCGGAGGGAAGGAGG + Intronic
954397112 3:50298772-50298794 GTGTGGGAGGTGAGGGGAGGGGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955953029 3:64261236-64261258 AAGAGGGAGATGAGGAAAGGAGG + Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956129381 3:66039344-66039366 CAGTGGGACCTGCGGCAAGGGGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
957017905 3:75091364-75091386 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
957374174 3:79335502-79335524 AAGTGAGAGCTGAGTGAAGGGGG - Intronic
957568052 3:81909470-81909492 CAGTGGGAGGTGGGGGGTGGGGG - Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
957922445 3:86762984-86763006 CAATGGGAGCCAAGCGAAGGAGG + Intergenic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
958678361 3:97294215-97294237 CAGTGGGGGCTGAGAAAAGGTGG - Intronic
958898192 3:99853911-99853933 CAGTGAGAACTGAGAGCAGGAGG + Intronic
959033201 3:101327402-101327424 GAATGAGAGCTGAGCGAAGGGGG - Intronic
960091693 3:113646474-113646496 CAGTAGTTGCTGGGGGAAGGTGG - Intergenic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960333741 3:116392169-116392191 CAGTGGGAGCTGGGGACAAGCGG + Intronic
960978692 3:123201839-123201861 CTGGGTGAGCTGAGGGAACGGGG + Intronic
961524736 3:127489523-127489545 CAGTGGAAGCCCAGGGCAGGAGG + Intergenic
961535672 3:127569072-127569094 CACTGGAAGCTGAAGGGAGGTGG + Intergenic
961605438 3:128091284-128091306 CAGCAGGAGCTGGGGGAACGGGG + Intronic
962278640 3:134033837-134033859 CAGTGGGTGATGTGGGCAGGAGG + Intronic
962396241 3:135017543-135017565 CTGTGGGAGCTACGGGAAGCAGG - Intronic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
962627182 3:137237444-137237466 CAGAGGCAGATGAGGGAAGTGGG + Intergenic
963239296 3:142987082-142987104 CAGGGGGAGCCGGGGGGAGGCGG + Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963352860 3:144174061-144174083 CAGTGGGAGTTGAAGAAAGGTGG + Intergenic
963371577 3:144407722-144407744 GAGTGGGAGATGAGAGAATGAGG + Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
967018795 3:185504594-185504616 GAATGAGAGCTGAGTGAAGGGGG - Intergenic
967092424 3:186146480-186146502 GAGCGGGAGTTGGGGGAAGGAGG - Intronic
967114620 3:186325840-186325862 CAGTGGAAGCTCAGTCAAGGTGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967267250 3:187701649-187701671 GAGTTGGAACTGAAGGAAGGAGG - Intronic
968066381 3:195761853-195761875 CAGGGGGGGCTGCGGGGAGGCGG - Intronic
968090093 3:195894031-195894053 GAGTGGGGGCTGAGGTCAGGTGG + Intronic
968135649 3:196217791-196217813 CCATGGGGGCTGGGGGAAGGGGG - Intronic
968143084 3:196274302-196274324 CACTGGGAGCTGGGAGTAGGTGG - Intronic
968287133 3:197515398-197515420 CAGTGGGAGCTGTGGGGTCGTGG - Intronic
968403263 4:316817-316839 CAGTGGGAGGTGAGCTCAGGGGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968661691 4:1801282-1801304 CAGGGGCAGCTCTGGGAAGGGGG + Intronic
968772217 4:2514691-2514713 CAGTGGGAACTGAGGACTGGAGG - Exonic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
969352583 4:6606315-6606337 CAGTGGCTCCTGAGGGAAAGTGG + Intronic
969484231 4:7463010-7463032 CACTGGGAGCTGAGATACGGTGG - Intronic
969520250 4:7674016-7674038 AAGGGGGAGCTGAGGTGAGGAGG + Intronic
969685555 4:8672148-8672170 AAGTCGGAGCTGAGGGCAGCAGG + Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970455461 4:16219325-16219347 CAGTGGGAGCACAGGTAAAGGGG - Intronic
970964111 4:21908249-21908271 CAGCTGGAGCTGAAGGAATGAGG - Intronic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
971081131 4:23212609-23212631 AAGTGAGTGCTGAGTGAAGGAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
972299369 4:37770672-37770694 CAGTGGAAGATGGGGGAAAGGGG + Intergenic
972305270 4:37824754-37824776 GAGTGGTAGCTTTGGGAAGGAGG - Intergenic
972957983 4:44415905-44415927 CAGGTGGAGCTGTGAGAAGGGGG + Intronic
973317796 4:48779922-48779944 TGGTGGGCGCCGAGGGAAGGCGG - Intronic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
975366401 4:73534205-73534227 GAGTGGGAACTGTGGGCAGGAGG + Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977296580 4:95216364-95216386 CAGAGGGAGCCGTGGTAAGGAGG - Intronic
977348209 4:95845130-95845152 GAATGGGAGCAGAGTGAAGGGGG + Intergenic
977607002 4:98993971-98993993 GAATGGGAGCTGAGGCCAGGAGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
979379068 4:119987038-119987060 TAGTGGGAGGTGGGGGATGGTGG + Intergenic
979468814 4:121071804-121071826 CCGTAGGAGCTGAGGGCATGAGG - Intronic
979654533 4:123176837-123176859 TTGTGGGAGGTGGGGGAAGGGGG + Intronic
980013555 4:127623134-127623156 CTGTGGGAGCTCGGGGCAGGTGG - Intergenic
981000401 4:139823640-139823662 CAGAGCGGGGTGAGGGAAGGCGG - Intronic
981343194 4:143646569-143646591 AAGTGAGTGCTGAGAGAAGGAGG - Intronic
981363169 4:143870993-143871015 GAATGAGAGCTGAGTGAAGGGGG + Exonic
981369954 4:143948659-143948681 CTTTGGGAGCTGAAGGCAGGAGG - Intergenic
981373899 4:143991787-143991809 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
981382995 4:144095042-144095064 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
981945607 4:150340043-150340065 GAATGAGAGCTGAGCGAAGGAGG - Intronic
982157274 4:152535389-152535411 CGGAGGGGGCTGAGGGGAGGGGG + Exonic
983552347 4:169030868-169030890 CACTGGGAGCCAAGGGATGGGGG - Intergenic
983790569 4:171792771-171792793 CAGGAAGAGGTGAGGGAAGGAGG + Intergenic
984856438 4:184199840-184199862 GAGTGGGAGCAGACGGAAAGTGG - Intronic
1202766184 4_GL000008v2_random:150477-150499 CAGTGGGAGGTGGGGGTGGGAGG - Intergenic
985629911 5:1008927-1008949 CGGTAGGAGGTGAGGGAAGATGG - Exonic
985970186 5:3370781-3370803 CACTGGGAGCCCAAGGAAGGCGG - Intergenic
986116559 5:4780989-4781011 CGGTGGGATCTCAGGGGAGGAGG - Intergenic
986482332 5:8202174-8202196 CAGGGGGAGCTCCGGGAAGGGGG + Intergenic
986503913 5:8429896-8429918 GAGTGGGGGCTGAGGGAGGCTGG - Intergenic
987001587 5:13665505-13665527 CAGTGGGAGAACTGGGAAGGAGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987711915 5:21511600-21511622 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
987714273 5:21546536-21546558 CAGTAGGAGTTGAAGGAATGGGG + Intergenic
988302495 5:29449183-29449205 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
989268283 5:39502880-39502902 CAAAGGGGGCTGAGGGAAGCAGG - Intergenic
990049582 5:51481030-51481052 CAGTGTAAGCTGAGAGCAGGTGG - Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
990918219 5:60933783-60933805 AAGTGGGAGCTGAGCTATGGAGG - Intronic
990973506 5:61536089-61536111 CACTGGAGGCTGAGAGAAGGTGG + Intronic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991171749 5:63634810-63634832 CAGGGGCAGCTGGGAGAAGGAGG - Intergenic
991432433 5:66562357-66562379 AAGTGGAGACTGAGGGAAGGAGG - Intergenic
991447744 5:66717971-66717993 CAGTGAGAACTCAGGGATGGAGG - Intronic
991645385 5:68795814-68795836 AGGTGGGAGGTGAGGGAAGGTGG - Intergenic
991762275 5:69930739-69930761 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
991785052 5:70187366-70187388 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
991841503 5:70805788-70805810 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
991877499 5:71187758-71187780 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
992375960 5:76188013-76188035 CTTTGGGAGCTAAGGGCAGGTGG + Intronic
992403478 5:76432932-76432954 GTGAGGAAGCTGAGGGAAGGAGG - Intronic
992896940 5:81253730-81253752 CTTTGGGAGCTGTGGGAAGTGGG - Intronic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
993720566 5:91317736-91317758 GAGTTGGAGGTGAGGGTAGGTGG + Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
993929151 5:93916672-93916694 TAGGGGGTTCTGAGGGAAGGGGG - Intronic
994407285 5:99360310-99360332 TTCTGGGAGCTGAGGGAAAGAGG + Intergenic
994691629 5:103026827-103026849 CAGTGGGGCCTAGGGGAAGGTGG + Intronic
994987206 5:106951823-106951845 CAGTTGGAGTTTAGGGAAGAAGG - Intergenic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995835674 5:116397218-116397240 CTGTGGGAGCTGAGCAAAGTGGG - Intronic
997263005 5:132478077-132478099 TTGTGGATGCTGAGGGAAGGCGG - Intergenic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997434628 5:133865440-133865462 CTGTGAGAGGTGGGGGAAGGTGG + Intergenic
998091527 5:139373679-139373701 GAGAGGGCACTGAGGGAAGGTGG + Intronic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998171188 5:139872881-139872903 CCCTGGGAGCTGAGGGGAGCAGG - Intronic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
998987436 5:147776366-147776388 GAATGAGAGCTGAGTGAAGGGGG - Intronic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
999239863 5:150121158-150121180 GAGTGGGGGCTGTGGGGAGGTGG - Intronic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
999461594 5:151761409-151761431 AAGTGGAAGCTGAGGGAGCGTGG + Intronic
999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG + Intergenic
1000179124 5:158790659-158790681 CATTGGGAGATGAGAGAGGGAGG - Intronic
1000328284 5:160188420-160188442 CGGTGGGAGGTGGGGGACGGGGG + Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1001144519 5:169172029-169172051 CAGAGGAAGCTTTGGGAAGGAGG + Intronic
1001400591 5:171444132-171444154 GAAGTGGAGCTGAGGGAAGGTGG + Intronic
1001978871 5:176023876-176023898 CACTCTGAGCTGGGGGAAGGAGG - Intronic
1002001279 5:176197578-176197600 CAGAGGGAGGTGGGGGGAGGGGG - Intergenic
1002238544 5:177819890-177819912 CACTCTGAGCTGGGGGAAGGAGG + Intergenic
1002253060 5:177941391-177941413 CAGAGGGAGGTGGGGGGAGGGGG + Intergenic
1002335110 5:178472046-178472068 CTGTGGGAGCTCAAGGAGGGAGG + Intronic
1002437781 5:179242747-179242769 GACTGGGATCTGAGGGAAGAGGG - Intronic
1002732953 5:181355300-181355322 CAATGAGAGCTGAGTGAAAGGGG - Intergenic
1002751584 6:118804-118826 CAATGAGAGCTGAGTGAAAGGGG + Intergenic
1002913605 6:1510475-1510497 GACTGGGAGCTGAGGGTAGAGGG + Intergenic
1003137046 6:3441708-3441730 GAATGGGAGCTGAGGGTGGGGGG - Intronic
1003261532 6:4521133-4521155 CTGAGGGAGCCGAGGGAAGTGGG - Intergenic
1003499927 6:6695559-6695581 GAGTGTGGGCTGAGGGATGGTGG + Intergenic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1004364878 6:15003526-15003548 CAATGGGATGTGAGTGAAGGTGG - Intergenic
1006163984 6:32053883-32053905 AGGTGGGGGCTGAGGGCAGGGGG - Intronic
1006164614 6:32057081-32057103 AGGTGGGGGCTGAGGGCAGGAGG - Intronic
1006595779 6:35191886-35191908 ATGGCGGAGCTGAGGGAAGGGGG - Intergenic
1006642711 6:35497095-35497117 GGGTGGGGGCTGCGGGAAGGAGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006721578 6:36156509-36156531 GAATGAGAGCTGAGTGAAGGGGG + Intergenic
1006845223 6:37056840-37056862 GACGGGGAGCTGAGGGAACGAGG - Intergenic
1006975011 6:38091802-38091824 CAGACGGAGCTGAGGCATGGAGG + Intronic
1007180152 6:39923731-39923753 CAGTAGGAGCTGAAGGGAGCTGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008419629 6:51282879-51282901 CATTGGGAGCTGGGGCAATGAGG + Intergenic
1009002453 6:57735543-57735565 CAGTAGGAGTTGAAGGAATGGGG - Intergenic
1009005789 6:57785088-57785110 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
1010280176 6:74014175-74014197 CTCTGGGAGCTGAGTGAATGTGG + Intergenic
1010906701 6:81500425-81500447 GAATGAGAGCTGAGCGAAGGGGG - Intronic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1012039261 6:94184302-94184324 AAGTGGGACCTGATGGGAGGTGG - Intergenic
1012289694 6:97437502-97437524 CTGAGGCATCTGAGGGAAGGGGG - Intergenic
1013257030 6:108397598-108397620 TAGTGGGGGATGGGGGAAGGTGG - Intronic
1013306931 6:108856740-108856762 CAATGGGTTATGAGGGAAGGTGG + Intronic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014901381 6:126969889-126969911 GAATGGGAGCTGAGCAAAGGGGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1016371428 6:143378224-143378246 GAATGAGAGCTGAGTGAAGGGGG - Intergenic
1016429408 6:143966811-143966833 CAGTGGGGGATGAAGGGAGGCGG - Intronic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1018141106 6:160837878-160837900 CAGTTGCACCTGCGGGAAGGAGG + Intergenic
1018200184 6:161387329-161387351 GAATGAGAGCTGAGCGAAGGGGG - Intronic
1018905576 6:168073547-168073569 CAGGCGGAGATTAGGGAAGGAGG + Intronic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1018998751 6:168729708-168729730 CAGTGGCCTCTGAGGGCAGGAGG + Intergenic
1019059017 6:169242604-169242626 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059061 6:169242729-169242751 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059159 6:169243025-169243047 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059193 6:169243125-169243147 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019237206 6:170627618-170627640 CAATGAGAGCTGAGTGAAAGGGG - Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019406626 7:887452-887474 CAGTGGGGGCTCCGGGAAGCTGG + Exonic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019575765 7:1736989-1737011 CAGGGGTAGCTGGGGGCAGGTGG - Intronic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1019729541 7:2622661-2622683 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1019729552 7:2622686-2622708 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1021578272 7:22125318-22125340 CAGCGGGAGTTGCGGGGAGGAGG + Intronic
1022249603 7:28594090-28594112 CACTGGGAGGTGGGGGCAGGGGG - Intronic
1022477752 7:30722884-30722906 CCTTTGGAGCTGAGGGCAGGGGG + Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023515407 7:40996732-40996754 AATTGGGAGCTGAAGGAAGGTGG - Intergenic
1023609592 7:41959326-41959348 CACTGGGTGCTGAGGAAAGGTGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024305916 7:47929518-47929540 CCGTGGGAGCTGTGGGAGAGAGG + Exonic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026307004 7:69151027-69151049 TAGTGAGAGCTGAGGCCAGGGGG - Intergenic
1026876910 7:73884688-73884710 CAGTGAAAGCTGATGGGAGGAGG - Intergenic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1027889398 7:83951195-83951217 CAGTAGGAGGTGAGTGATGGAGG - Intergenic
1028001838 7:85508570-85508592 CAGTAGGAGCTTAGGAATGGAGG + Intergenic
1028460257 7:91084527-91084549 CAGTGGGAGCTGTGTGGAAGAGG - Intronic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1029426253 7:100495808-100495830 CAGTAGGAGATGGGGGCAGGGGG + Intergenic
1030098208 7:105920341-105920363 CAGTGAGAGCTTAGTGATGGTGG + Intronic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1030324871 7:108208423-108208445 TAGAGGAAGCTGAGGGAAGGAGG - Intronic
1030750605 7:113227351-113227373 CTGGTGGAGCTGTGGGAAGGAGG + Intergenic
1031363690 7:120877855-120877877 CACTGGGAGATGATGGAATGGGG + Intergenic
1031456786 7:121990761-121990783 CTTTGGGAGGTGAGGGCAGGCGG - Intronic
1031920515 7:127596880-127596902 CAGTGGTAGCTGGGAGAGGGAGG - Intronic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032508675 7:132454946-132454968 CTGAAGGAGCTGTGGGAAGGTGG - Intronic
1032546894 7:132751349-132751371 CAGGGGGATGTGTGGGAAGGGGG - Intergenic
1034412640 7:150949212-150949234 TGCTGGGAGCTGAGGGAGGGTGG - Intronic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035315828 7:157997261-157997283 CAGTGGGAGCCCAGGCCAGGCGG - Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035399512 7:158555610-158555632 CCATGGGAGCTGAGGGAGGCTGG - Intronic
1035472216 7:159117694-159117716 GAGTGGCAGCTGAGGGTGGGTGG + Intronic
1035510562 8:178990-179012 CAATGAGAGCTGAGTGAAAGGGG + Intergenic
1035566594 8:645171-645193 CAGTGCCAGCCGAGGGAAAGGGG - Intronic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1035587178 8:785598-785620 CAGAGGGGTCTGAGGGGAGGAGG - Intergenic
1035587191 8:785632-785654 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587204 8:785666-785688 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587216 8:785700-785722 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587229 8:785734-785756 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587242 8:785768-785790 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587266 8:785836-785858 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1036033407 8:4994800-4994822 GAGTGGGAGATGCGGGGAGGGGG + Exonic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1036908433 8:12729498-12729520 CAGTGTGAGCTTAGTGAACGGGG - Intronic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037315958 8:17599808-17599830 CACTGGTAGATCAGGGAAGGAGG - Intronic
1037408019 8:18564738-18564760 CAGTGGGATTTCAGGGGAGGAGG - Intronic
1037768741 8:21787105-21787127 CGGAGGGAGGTGAGGAAAGGCGG - Intronic
1037796295 8:21998051-21998073 CAGTGGCAACTGAGGGAGAGGGG - Intronic
1037953424 8:23034481-23034503 CATTGGGAGGTCAGGGCAGGAGG + Intronic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039040023 8:33398743-33398765 GAAAGGGAGCTTAGGGAAGGAGG - Intronic
1039453402 8:37693450-37693472 CACTGGGAGCTCAGGGAGTGAGG + Intergenic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1040060629 8:43100284-43100306 CAGTGTGTGCTTAGGGAAGTGGG + Intronic
1040462700 8:47664129-47664151 CACTGGGGGCTGGGGGAAGAGGG - Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1040896381 8:52373253-52373275 CAGTGGGGGCTTTGGGGAGGAGG - Intronic
1041066864 8:54090890-54090912 AAATGAGAGCTGAGCGAAGGGGG - Intronic
1041186774 8:55308930-55308952 CAGTGGAAGCTGAAGAGAGGAGG + Intronic
1041324605 8:56651498-56651520 AAGTGGGACCTGATGGGAGGGGG - Intergenic
1041456874 8:58070354-58070376 CTGTGGGAGGTCAGTGAAGGAGG + Intronic
1041639747 8:60184467-60184489 GGCTGGGAGCTGAGGGAAGAGGG - Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041955935 8:63558415-63558437 CAGTGGGAGCTGGGAACAGGTGG + Intergenic
1042100319 8:65269406-65269428 CCGTAGGAGCTAAGGCAAGGAGG - Intergenic
1042137370 8:65645005-65645027 CCGGAGGAGCTGAGGGAAGTCGG + Intronic
1042422005 8:68602448-68602470 AAATGAGAGCTGAGTGAAGGGGG + Intronic
1042439782 8:68811471-68811493 CAATGGGAGCTGGGAAAAGGTGG - Intronic
1042960114 8:74294239-74294261 GAGCAGGAGCTGAGGGCAGGTGG - Intronic
1043345693 8:79295772-79295794 GAATGAGAGCTGAGTGAAGGGGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044177257 8:89142725-89142747 TAGTGGGAGCAGAGGGCATGGGG - Intergenic
1044457368 8:92403828-92403850 CTGGGGGATCTGAGTGAAGGGGG - Intergenic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1046770567 8:118112583-118112605 CAGAGGGGGCTCAGGCAAGGCGG - Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047816567 8:128470673-128470695 TACTGGAAGGTGAGGGAAGGTGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048025866 8:130586148-130586170 GAGTAGGAGGTGAGGAAAGGAGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049687545 8:143944963-143944985 CTGTGGGAGCTGGGGGACCGAGG - Intronic
1049702418 8:144021220-144021242 GAGAGGGTCCTGAGGGAAGGCGG - Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702490 8:144021494-144021516 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702697 8:144022341-144022363 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049703056 8:144023715-144023737 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703150 8:144024051-144024073 AAGAGGGTCCTGAGGGAAGGTGG - Intronic
1049703237 8:144024373-144024395 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703244 8:144024389-144024411 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703290 8:144024525-144024547 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703345 8:144024748-144024770 GAGAGGGTCCTGAGGGAAGGAGG - Intronic
1049796170 8:144498199-144498221 CACAGGGAGCTGTGGGAAGGTGG + Intronic
1049822707 8:144645828-144645850 CAGGGGGAGCTGGGGGCAGCAGG + Intergenic
1050186351 9:2979119-2979141 CAGTGGTGGCTGAGGGATGGTGG - Intergenic
1050255833 9:3790976-3790998 GATTGAGAGCTGAGTGAAGGGGG + Intergenic
1050818484 9:9846782-9846804 CATTGAGAGCTGGAGGAAGGAGG + Intronic
1050906026 9:11007336-11007358 TAGTGAGAGGTGAGGGAATGAGG - Intergenic
1051347420 9:16164786-16164808 CTGGGGGCTCTGAGGGAAGGAGG - Intergenic
1051783868 9:20721251-20721273 TGGTGAGAGGTGAGGGAAGGGGG - Intronic
1052879821 9:33594483-33594505 CAGTGGGAGTTGGGGGTGGGGGG + Intergenic
1052916463 9:33927322-33927344 CAGTGGGACCTTAGGGACTGGGG - Intronic
1052935473 9:34089335-34089357 CAGTGGGGGCTGAGAGATAGAGG + Intronic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053284480 9:36841486-36841508 GAGTGTGAGCTCAGGGCAGGGGG - Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053496159 9:38549746-38549768 CAGTGGGAGTTGGGGGTGGGGGG - Intronic
1053662823 9:40296224-40296246 CAGTGGGAGGTGGGGGTGGGAGG + Intronic
1053665598 9:40315212-40315234 TAGTGGGAGTTGGGGGTAGGGGG + Intronic
1053674313 9:40407809-40407831 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1053913270 9:42926399-42926421 CAGTGGGAGGTGGGGGTGGGAGG + Intergenic
1053915181 9:42940259-42940281 TAGTGGGAGTTGGGGGTAGGGGG + Intergenic
1054374951 9:64442448-64442470 CAGTGGGAGATGGGGGTGGGAGG + Intergenic
1054376753 9:64455242-64455264 TAGTGGGAGTTGGGGGTAGGGGG + Intergenic
1054385421 9:64547876-64547898 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054510308 9:65968481-65968503 CAGTGGGAGGAGAGGAAAAGGGG - Intergenic
1054519016 9:66061072-66061094 TAGTGGGAGTTGGGGGTAGGGGG - Intergenic
1054521791 9:66080060-66080082 CAGTGGGAGATGGGGGTGGGAGG - Intergenic
1054791433 9:69260250-69260272 TGGTGGGAGATTAGGGAAGGAGG - Intergenic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055983961 9:82036756-82036778 CACTGGTAGCTGTAGGAAGGAGG - Intergenic
1056306993 9:85300193-85300215 GAGTGTGGGCTGAGGGTAGGAGG + Intergenic
1056586271 9:87929560-87929582 CAGTGGGAGTTGGGGGTGGGGGG - Intergenic
1056610611 9:88123383-88123405 CAGTGGGAGTTGGGGGTGGGGGG + Intergenic
1056667047 9:88589371-88589393 CAGTGTGAGCGGAGGGGTGGGGG + Intergenic
1057042500 9:91857730-91857752 CGCTGGGAGCTGTGGGGAGGGGG - Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059383281 9:113945210-113945232 CAAAGAGAGATGAGGGAAGGGGG - Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059641305 9:116219549-116219571 GAGTGGGGGGTGAGGGAGGGAGG + Intronic
1059706873 9:116833033-116833055 GATTTGGAGCTGAGGGGAGGAGG + Intronic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1059974172 9:119698109-119698131 CGGTGGGAGGTGAAGAAAGGAGG + Intergenic
1060180003 9:121527436-121527458 CAGTGGGGGCTGGGGGCTGGGGG + Intergenic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060471388 9:123951447-123951469 TGGTGGGAGCAGAGGGAATGAGG + Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060822197 9:126667940-126667962 GAGTGGTAGCTTAGGGAAAGCGG + Intronic
1061246779 9:129404727-129404749 CACTGGGTCCTGAGGGCAGGTGG - Intergenic
1061466039 9:130780589-130780611 GAGAGGGAGATGAGGGAAGAGGG - Intronic
1061520181 9:131113143-131113165 CAGTGAGAAATGAGGGAGGGAGG + Intronic
1061957232 9:133970031-133970053 CAGCGGGTGCTGAGGCCAGGGGG - Intronic
1062000780 9:134214671-134214693 CAGTGGGAGCTCAGGTGGGGGGG + Intergenic
1062003743 9:134229239-134229261 CACTGTGGGCTGAGGGACGGAGG + Intergenic
1062207087 9:135343180-135343202 CAGTGGGACCTGGTGGAGGGTGG - Intergenic
1062212185 9:135371150-135371172 CAGGGGGAGCTGGAGGCAGGAGG - Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062388977 9:136326686-136326708 CATCGGGAGCTGAGGGTGGGTGG + Intergenic
1062504265 9:136865469-136865491 GAGTGGGAGCTGGGGACAGGGGG - Intronic
1062554123 9:137106376-137106398 CCGTGGGAGCTGGGGGCAGCAGG - Intronic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1062615329 9:137393581-137393603 CAGTGGGTGCTGAGGGCTGTGGG - Intronic
1062757360 9:138307626-138307648 CAATGAGAGCTGAGTGAAAGGGG - Intergenic
1203361741 Un_KI270442v1:222382-222404 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1203546932 Un_KI270743v1:135366-135388 CAGTGGGAGGTGGGGGTGGGAGG - Intergenic
1185581381 X:1213262-1213284 AAGGGGGAGGGGAGGGAAGGGGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1186207162 X:7213047-7213069 CTTTGGGAGGTCAGGGAAGGAGG - Intergenic
1186207271 X:7213836-7213858 CTTTGGGAGGTCAGGGAAGGAGG + Intergenic
1186223822 X:7376248-7376270 CAGTGGGAGCTGGGAACAGGCGG - Intergenic
1186302589 X:8216773-8216795 AAGTGGATGCTGAGGGGAGGAGG - Intergenic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186714141 X:12232386-12232408 GAATGAGAGCTGAGTGAAGGGGG + Intronic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187380216 X:18794794-18794816 TACTGGGAGCTGGGGGAAGAAGG + Intronic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187941742 X:24389308-24389330 GACTGGGAGCTCAGGGGAGGTGG + Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1188707311 X:33351296-33351318 CAGTGGCTGCCTAGGGAAGGTGG + Intergenic
1188843745 X:35047712-35047734 CAGTGGCAGCTGAGAGAATGAGG - Intergenic
1189667744 X:43375571-43375593 CCGTGGAAGGTGGGGGAAGGAGG - Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190797753 X:53760307-53760329 ATGGGGGAGCTGAGGGCAGGCGG - Intergenic
1190917403 X:54820907-54820929 ATGGGGGAGCTGAGGGCAGGCGG + Intergenic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1191699496 X:64024539-64024561 AACTGGGGGCTGAGGGAAGATGG - Intergenic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1191885475 X:65883629-65883651 CAGTGAGAGGTGAGGAATGGAGG - Intergenic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192183973 X:68933955-68933977 CTTTGGGAGGTGAAGGAAGGAGG + Intergenic
1192296442 X:69854164-69854186 CAGTGGGGCCTGTCGGAAGGTGG - Intronic
1193406234 X:81105829-81105851 CTATGGGAGCTGAGGGTCGGGGG + Intergenic
1193543460 X:82799049-82799071 CATTGGCAGCTGAGGGCAGATGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1194302479 X:92204882-92204904 AAGTGAGTGCTGAGCGAAGGAGG + Intronic
1194365382 X:93007570-93007592 GAGTGAGAGCTGAGTGAAGGAGG + Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195403966 X:104492538-104492560 AAGTGGGAGCTGGGATAAGGAGG - Intergenic
1195847988 X:109249003-109249025 GAGTGGGAGCTGAAGTAGGGTGG - Intergenic
1196736018 X:118981691-118981713 CAGAAGGAGCTGGGGGAATGCGG + Intronic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197906820 X:131434237-131434259 CACTGGGACCTGTTGGAAGGTGG + Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199103679 X:143837393-143837415 CAGTGGGAGCTGTGGACAAGCGG + Intergenic
1199603495 X:149557851-149557873 CAGCCGGGGCTTAGGGAAGGAGG + Intergenic
1199646892 X:149921624-149921646 CAGCCGGGGCTTAGGGAAGGAGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1199928012 X:152489888-152489910 GAATGAGAGCTGAGTGAAGGGGG - Intergenic
1200081580 X:153579370-153579392 CCATGGGAGCTGGGGGATGGAGG + Intronic
1200673599 Y:6123828-6123850 GAGCGAGAGCTGAGTGAAGGAGG + Intergenic
1201368589 Y:13235419-13235441 CACTGGGAGCTGAGGACAAGTGG - Intergenic
1201691806 Y:16775161-16775183 AAATGGGGGTTGAGGGAAGGAGG - Intergenic