ID: 1197177965

View in Genome Browser
Species Human (GRCh38)
Location X:123504780-123504802
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197177954_1197177965 14 Left 1197177954 X:123504743-123504765 CCAGGTAGCACGGAGAAAGAATC No data
Right 1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG No data
1197177951_1197177965 26 Left 1197177951 X:123504731-123504753 CCCAGGTAGCAGCCAGGTAGCAC No data
Right 1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG No data
1197177952_1197177965 25 Left 1197177952 X:123504732-123504754 CCAGGTAGCAGCCAGGTAGCACG No data
Right 1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG No data
1197177950_1197177965 27 Left 1197177950 X:123504730-123504752 CCCCAGGTAGCAGCCAGGTAGCA No data
Right 1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197177965 Original CRISPR AGGGAGAGCACAGTGATTTG GGG Intergenic