ID: 1197178978

View in Genome Browser
Species Human (GRCh38)
Location X:123513915-123513937
Sequence AATAGTGGGAAGCGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197178978_1197178985 -2 Left 1197178978 X:123513915-123513937 CCTCCCACCCGCTTCCCACTATT No data
Right 1197178985 X:123513936-123513958 TTTTTAATGTAATATATACCCGG No data
1197178978_1197178989 18 Left 1197178978 X:123513915-123513937 CCTCCCACCCGCTTCCCACTATT No data
Right 1197178989 X:123513956-123513978 CGGAAGAAACACTTCAGAGGTGG No data
1197178978_1197178986 15 Left 1197178978 X:123513915-123513937 CCTCCCACCCGCTTCCCACTATT No data
Right 1197178986 X:123513953-123513975 ACCCGGAAGAAACACTTCAGAGG No data
1197178978_1197178991 20 Left 1197178978 X:123513915-123513937 CCTCCCACCCGCTTCCCACTATT No data
Right 1197178991 X:123513958-123513980 GAAGAAACACTTCAGAGGTGGGG No data
1197178978_1197178990 19 Left 1197178978 X:123513915-123513937 CCTCCCACCCGCTTCCCACTATT No data
Right 1197178990 X:123513957-123513979 GGAAGAAACACTTCAGAGGTGGG No data
1197178978_1197178992 24 Left 1197178978 X:123513915-123513937 CCTCCCACCCGCTTCCCACTATT No data
Right 1197178992 X:123513962-123513984 AAACACTTCAGAGGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197178978 Original CRISPR AATAGTGGGAAGCGGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr