ID: 1197184665

View in Genome Browser
Species Human (GRCh38)
Location X:123573356-123573378
Sequence GAGGGTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197184654_1197184665 23 Left 1197184654 X:123573310-123573332 CCAGTTCATCTCACAGGGACTGG 0: 4
1: 116
2: 354
3: 430
4: 408
Right 1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG No data
1197184653_1197184665 24 Left 1197184653 X:123573309-123573331 CCCAGTTCATCTCACAGGGACTG 0: 3
1: 91
2: 596
3: 1047
4: 1376
Right 1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197184665 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr